Description :
From Genome Similarity Track
Location :
contig_118:36273- 39201
Transcript NameFunction/comments
g13333.t1hypothetical protein

Sequence
2928 bases(100 bases per row)
GTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAAT
GGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGAGTAGCTAACAGAACTAATGAACCAACTTTGA
ATTCATTTGTGTTTCCCCTGCCGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGGTTTAAA
GTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCT
TATCCGGTTGTTTTGAATTAACCGGATATTCCTCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACG
TAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGC
TCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGT
AAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGA
CATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGT
TGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGG
CTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTC
TCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGT
CGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGG
TGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACG
ACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCT
GGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGAC
CACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCT
GGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACA
CAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCA
TTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAAC
TGCCGCAGTTCCTTTATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGT
ACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCA
TCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGAC
GCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATA
TCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAG
GTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGC
GCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGT
CGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCT
TGTACTCACGCAAGACCTTGTAAAAGGG