Description :
From Genome Similarity Track
Location :
scaffold_9:362724- 364520
Transcript NameFunction/comments
Plaha_PHALS_02592pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase
Plaha_PHALS_02593nad dependent glutamate dehydrogenase

Sequence
1796 bases(100 bases per row)
GATGGTGTCGTCATTTTCCGGTGGTGTTGTGGCACCTGTGCTTACTCAAGTGAATCGCAAGGGTCTTGATGCGATTTGTCAAGAGACCCAAAAGGTTATT
GCTAAGGCCAAGGATGGGAACATTGAACCAGATGACTTAGCTATCGGCACTTTTACGATAGCCAATGTTGGTCAATTTGACGTGCAGTCGATGGCTGGTA
TTGTGCGTCCGGAACAAGCCTGTCTTTTAGGCTTGGGCACAATCGAAAAGAAGGTGGTCCCGAATGATGACCCAAATGCAGAGCAGATTTATAAGTACGC
GCAGGTGATGACGGCGACGTTGGCATGCGACCACCGAGTAATTGATGGAGCTGTCGGTGCACAGTGGTTGGCTACCTTCAAAGAGCTCGTGGAGGATCCA
CTCAAGATGATTTTGTAAATGGCGCAATCAAAATAGACCATGAAGACAAGCAAAAATAATTGTGTTCTTCCAGTGTCGTTGATTCTTGATGTCGTGTGAC
CCTTGTTGTCTGCTACTAAAATGGTAATCAGATTTACTTTTGTTCTGTATATCGTGGCCCCCAGGAGCCAAATAAATTGAAGGATAGTACAGTCGTTGGT
CATACTCAATCGCATCAAAATCTATCAATCTAACTACACAAAATTCGAATGAAGCTTAAGCAGACCAGAGCATCGTCAGGCAATGTATCTTGGTACTTTG
TTAATCTGAAAAGACATTGGGATACCTCTTCTTCTGAAGAAAGCACTAATTAAGATTAGAGACATTATGATTTGCAGTATATTTTGCTCAAGTTGAGCTA
TGACTAGAAATGCATTGCAACTGACAACGATCTTTTTTGTGTTTCATATAGCCATCATGCGTAACAAGATCACAGGCTACTTATTTCCAATTAGCTCCTG
AATAAACTCGTAGAACGAAAACTCAGGCGCGCCAAGTCCGACGTTGTAAATAAAGCGGCTGGCAAGTTGAGACGCAAAAAAGGCACGAGTATAACTCTCA
GGTAAGCGTCGAAACAGCTCCTCCTTTGGAATCATGCCCAGCAAAATTTCGGGGAAGCCATCGGCAAAGATTTTTTCCCGTAGTGGCTGGTTCTCCCAAA
GTCCTGAGTGTTGAATCTTAGCACTCAGGTCAGTAATACGCTCGCTTAGTTGATTGGTCAGCACCGAGTAGTACATGCCCGAGCGCTCGTGCTCGCGCCA
GATACATTCAAATTCATGCTGAGCGTTCAGATCAATGCGATTCTGCACTTCATTTACATAGTTAACGTAAAACGTGGGATGCTCACCAGTAGCTTCGTTC
ACCAGCATGTGTTCGGCAAACTCCTCGTCCGTCATGGATAATGCAGCTAGTACTTCAAGCGACGACGACGTCACACCTCCTTTATTCGCGGACGCGTCTT
TGAAAAGGATTACGCCTGCATCTTCAAGACGGATGCGGGCGTCCTGAGAGAAAAATAAGTTGGCACCCTCTACGATGTATTTGAAACGTAGTGTCCGGCC
GTCCTCTCGATACATGAATCGCTCGACGTTGTTAAGAtttactgcagcggggcggCCACCACATGGCACAAAGAAGTCAGCCGTGAGACTTGGACGTAGA
TGAAACAGATTGCGGAATTCTGTGCCATTTTCCACGACTTCACCATTCggaagtgtgacgtcattgtgCGAAACGAGTACCGAGAAGCCGTCCGAAGACA
GTAAACTCGTATCAAAACCCGAAATTGGACAACGTTCCTCCGCCAGCTTGACAAGAAACTCGCGATTGATGCCTTTTGGATCATAAAGTACACCCG