Description :
From Genome Similarity Track
Location :
Scaffold_51:36268- 37768
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_51-fgenesh-gene-0.4Pre-mRNA-splicing factor prp46

Sequence
1500 bases(100 bases per row)
CCGTACCTGTTCTCGGCTGCTGAAGACAAGAAAGTGCTCTGTGAGTGATCTCACTGTTGGCACTCTCCAGTTTGTGTCTGCCTCTTGGGTTGTGGCTCAT
AATTTGTACTTTTCTTCCTGATGAAATAGGTTGGGACCTGGAGTACAACAAGGTGATCCGCAGTTACCATGGTCACCTGTCGGGTGTGTTCTCGCTCAAG
ATCCACCCAACGCTCGATGTGCTGGTGACCGGCGGGCGTGACGCGGTCGCGAGAGTACGTGCTGCTGCTGTGGCTCTTTCGTAGTTGCTCGCATGATGTG
ATTCTAATCGGGATGATGTGCATGTTGCTCTAGGTGTGGGACATGCGCACGAAGAACCAAATCCACATCTTGTCGGGCCATCAGGGCACGGTCTGGGCCA
TGGAGACGCAAGCCACGGACCCGCAGATCATCACGGGCTCGAGCGACAGCACTGTCAAGGTACACGCCGTGTTTATTTATGACTTGGACAATGGTCTTCC
TTGTTGTTGCTGAGCTAACTAAGCTAACTCTCCTGTTTGTGTGCTTGGTATGTGTGTAGTTGTGGGACTTGGCTGCCGGAAGAGTCATGACGACGCTGAC
GAACCACAAGAAAGCGATCCGAGCGATCGCCAAGTCTCCGATTGTACGTGCTTCTTAAGTCAATTGTGCGCGCTGGACCTTGTCTAATCCAAAGGTGCTC
TTTCTGTTTGTGATGCTATTAACAGGACCATACATTCATGTCTGGCGCGGCCGACAACATCAAGAAGTGGGAAGCGAAAGAGGGGCGCTTCCTGCGCAAC
TTCTCGGGCCACAACGCGATCATCAACTCGCTCGCGATCAACCAGGACGGCGTGATGGTCTCGGGCGCGGACAACGGCTCGATGCGCTTCTGGGACTACA
AGACCGGCCACTGTTTCCAAGACGAGGTCACGAAAGCGCAGCCGGGCTCGCTCGACAGCGAAGCAGGCATCTTCGCGTCCACGTTCGACAAGACGGGACT
GTACGTGGCTTGCTCCTGCCTAGCATTGCTGCATCTGAGTTTGGTGATGGATTTGGAAGAAAGATAAGCTCACTCGAATGTCTTATTATTATCCACAGGC
GTCTGATCACGTGCGAGGCGGACAAGACGATCAAGGTGTGGCAGGAAGACGCGACGGCGTCCGAGGAGTCGCATCCGATCGACATGGCGCAGTGGACCAA
GGACTTCACGGCGCCGAAGCGCTATTAGCTTCCCGTCTTTCGAAGTTCATAGGATTCGTGCATTCTTTTCTCTCATGAGCAGCAAGCAACAAAGATATTT
GGTTTGCTATAAATCGGTCGCACTCGAATGTTTGACAAAGAACATTTTTCATTCAAAGACATGGGATTGCGTGGGCTTGTCGGCTGTTTGTCCGATCATC
CTGAGCAGGCAAAAAAAAGGTGAATGAGCTGCTTTTTGCTGTTGCCATTCGACGAACAAGAGCGAGAAAGACCGCAACCAAAGGGCACCACCACACTGAG