Description :
From Genome Similarity Track
Location :
Scaffold_111:36252- 37697
Transcript NameFunction/comments
Phyca_LT1534531328Major Facilitator Superfamily (MFS)

Sequence
1445 bases(100 bases per row)
cgcagagcggtcgctcaaaccgacatggatcgtgtactcttccgtcgctatcgccatgctcgaagccttccactacggttggtccaactcccaagtcaac
ctcagcaccttcagcaacacggacgactgcaacgcgcggccagtggaggaaggcacatgcctcatgttcccaggtcacaccaagacgacgtggacgctgc
tggtgaactcgtggatcgtaggtggcatgttcggtagtttgctgtctgggttcccgtccaacaagtgggggcgtcgcactacgctacgcttcaacgcgat
catcatggtcttcggttctgtgattcaagtggtagcgaacaacccgacgtggttcgctacgggtcgattcgtgacgggcgtggcgaacggcgtggcgatg
gccgtggtgaacacgttcctgaacgagatctcgacgccgcacaaccgccacgcactgggcacgaacacgcatttggctgcgacgttgggtatcttcggcg
tggcgacgacgttctggtactggaacacgacgtcgggtttccgttggatcgcgggtatgccgatggtatttgctggtgttttcgtggtgatgtcgttctt
cttcatggtcgagagtccagtgtggttggtggctaatggaaaggatgaagaagctgagaaggagctcggtcgactgtatgggaaggagaacgttaacgct
atgatgggttggattcaagccaacgatcgtcgatccaaactgccttcgatgttgagtggtgtgtcagataaagtccacacggagaccaactggacgattc
tgaccaacaagaagttccgcaagccgctgattatcgctcttggacttacgtgcatcaatcaattggtgggtatcaatgctgtcttcttctattcgtcgtc
tatcctgaaagacgccggtatttcggactcgcgtgttggcctcatgatcattgacatcctcaatgttgttcctgtcccgatcgctgctgcattaaccaag
gtcatgcgtaagcgtacaatgcttatctctggtatctccgtgatggtattgtgctgcatcggtatgaccttctcactggtctacagcatcggttggctct
ccattgtcttcctcggtatctttgtggtgggttacgacctgagcattggtccactgctttggccgatcgttgctgaactcttcgctgattctgctcgagg
cgctgccgtcggtatttgcatcacgatgaagtggatctgctcgctcatcgtgggcatcggcttcccgtatgtggaggaggccatcacgaactacagcttc
acgccgtttctgggcacgaccatcctctccatcatcttcatctacttcatggtgccggagacatcggacatgaccattgccgagatccaggacggattcc
gcagcgatcgtagtgtgcagtcgtcgagtaagagtcagatgtaag