Description :
From Genome Similarity Track
Location :
Scaffold_976:3625- 7465
Sequence
3840 bases(100 bases per row)
ACTCAAGATCCTTGTCGGACCATCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGT
TTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGCATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCT
TGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGAT
CCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGC
CTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAG
CGGGATTAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGA
ACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGATTCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGTTTGAGTGTCTTGGCGAGACGT
GGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGAT
CGTGGATCTGGCCGTAGGGTTCCTTGCGGGTGTGTTCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGGCTGTTGAGGTAATCCAATACGATCCCGCGATGATTACGGTAGGATGTTTACGCCACCGATGA
TTAGACGAGTAGGATGATTGGACGAGTACAGAGGGTTGGTGATTGGATGCACCAAATGATTGGATGCAAACTAGGTAGAGAAGACAGTGTAAGTTCTTAT
CAATCAATCACTTCTGAATTTCCATTCTGCCCCTCAAGTAACTTCCCTCGCCTCGGCCTCCTCGCCCCAAGCTTCGGCAGTCCTCCCCTCGCAAGACACA
AGATCCAACCATCACCTTCTTCAAAGCGCAAGGGACGACAGGCGCCAAAGACAAGCGCGTGTCACTACTGCGGCGAACAAGGACATTGGATCGCCAAGTG
TCCGGTGAGGATTCGTGAGAATGCGGAGCGACAGAGGCCGCAGCGAGCAAACGTCGCTCGCGATGAAGAAGAATCGGGCGAGTTTCTCTTCTTGGTTGGT
GGTGCGAGCAAGACCACCAAGTCAAGTGACAAGTGGCTGGTCGACTCGGGTGCGACACAGCACATGACGTACTCGAAGGAGTACATGAAGAACTACAAGA
AGATGTCTCCAGTGGACGTGCATCTCGCGGACGATGGTGTGGTTCAGGCGGTCGGGACCGGTGACATCGTGATGTCCATGAAAACTCCACGGGGGACCAA
GAAGGGTGTGCTCACGAATGTGTGGCACATTCCTAAGTTGTCACACAACCTCTTCTCGGTTGGTCGCTTCACCAAGGATGTTGGTCCCGTGACGTTCGAG
ACGGATGGGTGTTTTGCGGAAGCAAAGGGTCTCAACTGGAAGCTCGGCGCGCGTGAAGGCAAAGGGCTGTTCAAGCTGTGCATGACACCAGTTGTGCCCG
ACGAGGCCAATGCGGCAAGCTCGAAGGATCGCAAAGGGGACACCACATCGTACCTCTGGCACCTTCGACTTGGTCACATTGGCCATGGCGGTCTAGACGC
CATCGTCAAAAAGAACTACGGTGCGGGCATCAATATGACGTCGGTGAAACAGTGGGAGCTGTGCGATGGATGTGCACTCGGCAAGCAAACGCGAGTGAGC
TACATGTCCAAGTCACCTATCCACGCCAAGAAACTGCTGGAAATCGTTCACAGTGATGTGTGTGGGTCCCATGCAGACGTCGACATTCAGTGGCAAAGCT
ACTTTGTCACGTTCATCGACGAGTACTCGCACTTCTGTGTGGTATATTTGCTCGGGAACAAGTCAGAAGTGGCCGACAAGTTTGCTGAGTTTGTCGCATT
TGCGGAAACACAGACCGGCAAAGTCGTCAAGACGCTTCGTAGTGACAACGGTGGCGAGTACACGTCGGGCGAGATGGCTGAGTTCTGCAAGCGTCGTGGT
ATCGTGCAGAAGTTTACGCCTCCGTACACGCCTCAACTAAACGGTGTCGCCGAGCGGATGAACCGGACGCTGGTGGAATGTGCGCGCTGCATGTTGGAGC
ATGCTGGTTTGGCTAAGTCGTATTGGGGGAAGCGGTAATGACCGCTGCGTTTCTACGTAACCGGTGTCCCACACGTGCCATCAGCCATGACAAGTCACCG
CACCAAGTATGGACCGGTAAGAAACCACTGCTGGCGAATCTGAAAGTGTTCGGTTGCCATGCGTATGTGACGGTTCCGAAGCAGAAGCGCACCAAGTTGG
ACGCTCGAGCAGTGAAGTGTCGGTTTCTGGGGTACTCGGAGCACGAGAAAGCGTATCATTTCGAAGCGATCAAGAGCGGTCGTGTGCTAGTAAGCCGCGA
TGCGCATTTCATGGAAGACGTCTTCGACGGAGGGAGACGCAGCCACGATGAAGATGACATCGTGGAGCTTCAAGAAGAAGAAGTGACGGATCAAGAAGCA
TCGTCCGAGGATGAGACGATGGGAGACACTGCGCCGCGTCAAGAATTTGAGCCCGGCAGCAAGCGACACCAGCGAACGCAGTCGTTGGAGGAAGCGGTAG
AGATCCCGCGAAGCAAGCGACAGAGTCGGCCGCAGACACTGGAGGAGATGTCAGCGGTCGCAAGTAGTCGAGAAGAAGATTTCGAAGCGGCCTACGTTGT
GGATTCAGTGGGAGAAATGCCGACTACGTTCAAGTCGGCGATGGAATCCAGCAACGCGGCCAAGTGGAAGGAGGCGTGCGACTCAGAAGTCGAGTCTCTT
CGCAAGAACAAGACATGGTCGTTGGTGCCATTGCCCAAAG