Description :
From Genome Similarity Track
Location :
Scaffold_2190:3625- 5402
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2190-fgenesh-gene-0.3Striatin-3 family protein

Sequence
1777 bases(100 bases per row)
ACTGCTCGTCAGCGGTTTATATAAGCAGGTGTCAGACATGCGAAGTGGACTCACCTCCAGTCGCAAAATATAACCCGCCGGCATCGATGGAGATAGATGA
CACGGCATCTTGGTGGGCAACCATGCTCGCCACACAGTCGCCTAAACAGAGAGACACGACGAGTCAGCAGGTGCCACAGATATAGGAAACTCGCCTTCGA
CGCACCAGATCGCATATCGTAGATGCGGATTTTCCGATCTTGGTGGGCAGTGATGACGATAGGCATCGAAGGGTGCACGGCCAGGCGATTGACTTGCGAG
TCGCGACCAGCGTTATCGCAATCCGACGTTCTCGCCATTTGAAGAAGTTTCTCGCCGTGGAAGTCGAACTGGGCGATGCCGCCGTTAGTGTACCCGACGA
CACAAGTCTTGGAATCGCTCAATAGCGTGTGGACTGACGTCGGAATGAGCGAGCCACGGACGCTGTGGCCTGTAAAAATGAAGGGGGGGTAAGATATTTC
GAACGGCTTCCCCAGAGAACAGAAGCAGGATTGACGTACCGACCGCACGAGCATGGGACTTGTTGGTGCACCGCAACTCTGACTTCAAGCTCAAATCTAT
ACAACGGAAAGCAAATGTTAGCCCAACCGTATGCTCCGCCAACACCAAGAGGTGGTGGCCACGAGCATACCCGATGACAGCCCCCACGAGCGGACGACAC
CGTCCGAGCCGGCAGAGAAGACCACGTTCGTTAGCGGGTGTGCGTGGAGATCCCACACGGCGTCTTCATGGGCACGCTTGATGGAGTGCGCCCGCAGCGC
ATTGTAGTTTTCAATCGTGTACGGATCGCCCTTGTCGTGGTCTGCGACGGGCAGGTTGAACAGACAGATCGCGCCGTCGCGCCCGGAAGTAATAAACGCT
CCAGCACTTCCTTTCGGACAGTTTGGATACGTCTCGGTACCCACGGTCGCAACGGCGAGTACGCTTTGGGCGTGGGCGCGCATCGTGAGGATCGAGTCGA
GCTCGGCCGTTCTATGCGCACAATGAGATGAGATCGAAACGCAAGCCAACGCCGATCTCTGGGGAAACCTTACCGTTGGGACGGCGGTCCGTTGATGGCA
TTCGCGAGGTTCCACACGCGAACGGAGCAGTCTTCGCTACCTGATACGAGAATCGGTTCCGTCGGGTGGAAGGCAAGCGCTCGCACTCCGTCCTACATGA
GCGTCACGTTAGATATCTTGCTTCTGATGCAAATAGGCAACAGCAAGTCGCACCAAGTGTCCAGAGAGCTTTAGCTTTAACTTCAGCGGGCGGAACGACG
ATTTGACGACGGCCGACGCGGACTGCGACTTTGACTCTGGCGGAGTGGCACCAGATCCAGTGCGCGAGCCCATGCGAGGGCGGGAGATCTCGAGTCCCTT
GCTCGCCGATGGGTTGTTGCTTTCGGTACGATAGATCTGGGCGTGCGGCTTTGGACTGCTCATGGGCGACTCCACGAAAGAATTCGTCATCGTCCGATCG
ACCGTGCGCGTCACAGTGACTCCTGCTGGACGCGAGACGTCGCGCTCGACCTTACGGGATGGCGCACCGTTCGACGTCGATTTGTGCAGTGACGTGATCA
CTGGTGCGGGCGACACAAGATACCGACCGCGCTCCTACATACCATGTCAGTACACTACGCGTCTTCATACTTCGAGTGTCGGCAGCGCATTACCTGTCGC
AGCGCAAACTCGAGCATCTTAACGCGCTGGAGCGCCTCTTTGTAGGCGTCCTCCTGCTGCTGGCGCTGGCTCTCCAG