Description :
From Genome Similarity Track
Location :
Scaffold_472:3625- 5289
Sequence
1664 bases(100 bases per row)
AGCTTCACCCTTCGGGCTCGCAATATTACGACTGCAGCACTCTGAATAGATCCCGGATTGGTAGATCACGATCAAATTCTTGCTTCAGAGCTCTGCAGTT
CAAATTCTATTAGTCTACCTATGACATATCATTTTAAGTTTTCCAGTGTACCAAGAATTGACGATGCACTCGACCGTAACGTGGCTTTTCACCCGATTTT
ATGTGTGCCATTCATTCCACTTCGAATTGATCATCTTCCAGACCACCTTCTCAAAATATCCTGCGACAAGGGTACTTCATCAACATTAACTAGACCCGTT
TCATCCACGTTGAAACGACCGGTAGGACATTCTGGGAATAATCTCACATGGTTCGATTTTGAAACTTGAATTACGGGAAATAACCGGTAGGATGTACCCG
CACTTTATAAATGCACCGCGTGATCTCCACATTGGCTCGTCACCCGAAACGGTACATGCCACATATGGGATATATTTTGTACATATCCGTCTTTCGCGCA
ATCCAGGTAAAAGGACTCCCGCGATCCGCGGTCGACTTCCAGTAGATCTTAATTATCATTATGGGGATTTTGGATTGCGATCTTAAGTCGATAATTTGCG
TTGGCCCTAACACGCTGATATTTGTGCTGTTTGTTATATCGCCGTACGCTAAATCTCGATGACGCACCTCAGTAATCGCTGGTGAAATATTTTGTTTACG
TGTTGCAGGTGGCGGCCGCCACCCACGGCTCGACGAGGTCGAACACGTCTTCTTTGATCATATCCTGGTCGAACGTCGATCGCGGATCCCAGACGTGAGT
CAGGTAAAACGGTGTATTTCCGTAAGCACTATCTCGCGCGGTGTTGATCGCGTAGTTTTATCACTCTGCGTATTCGTTACAGTAATTTTGTGCTCGTCCG
GAACATACGCCTAAATTGTTCATTTCAAAGTCTGCACTATGCGTTTATCCAGATGGTCCAGACGTTTGCTTGAGGCCTATACGCCGTAGTGGCTCGCTTT
TTTGCCCCTAATTCGGTTAAAACTCGAAAAAAATCAGTCATGGACTTCTGTTCTTCAGTGTGGAATATTGCTGTGCTCGTAATGACACGCCGGAACACAC
AATGTTCGTATTCACCGCGATTGTCTGGGCAGTTTGAGTGAAGTTGCTTTCGCGATCATGTAGCACGAGAATATATTGAAGTATATCAACAGCTCTGCAC
TCCCTTTAAATGATCGCGGAAACGACGGAATGTGATACGTAGCCATTATTTGAAATCAGTTAGTTTCTTTCAAGCGACTAGGTGACCCACCAAGATCGTA
TGGACGACCTCTGCTTGTCTTATAATCATCACATACATCGTAGTAACGTTGCACATTCCGATACCACCATCGCCAGCGAAAAGTCACCGTGATCTGTTGA
TATGATTGCTCCTCCTGTGGTGGCCATATTTTTTTAAATATATATATGAGAATGGTGCAGGAAGGGTTGCTGCAAGAGTTCTAGGATCACTAAACGAATG
GACTCCTCATGGACTTTCGACTTAGCCGATATCAGGTAGAAAAACAACAAGCCATCGTGATCCACTTTATAAGAAGGCGCGAGCAGGGTGCAAACTTTCG
CCTCTCCTGCCTGCTATTCGGCTATATTCCCGATCATGTATTATTTTTACTCGGACATCCATTT