Description :
From Genome Similarity Track
Location :
Scaffold_1669:3624- 6472
Transcript NameFunction/comments
Phypl_g13927hypothetical protein

Sequence
2848 bases(100 bases per row)
CTGCCTCAATTGCATCAACTAGACCCTCTTGTGTATCGGTGAGCACCAAGAGATCATCAATCCACCCGATCACGCAAGTGTTGGTAAGATCACCGAGAAC
CATTTCGACTGTAGATTGGAAATGCAGTGCAGCGTCGGTACTGCCCTGGGGTACTCTGGTTGGAGTGAATACACCCTTGTCGGTCATATAAGAGGAATTC
TCGGCAGCTCTCGTCCAAAGGAAGCTGCCAGAACCCTTTCAAGTAGTCGAACACTGCATATTACATCACCCCTTTGCAGTGCTCAAGTGTCACTTCAAGG
CTTGACATTATTCCAGCTATTGGTTCGGTCATGGCGTTTGTAGGCCTGTACTCAACGGCCTGTCTGAAGTCCGTCGTATTTGACTTCATGATCGGCAAAG
CCCGACAATACCACCGCCTCTCGCGGTTCTCATAGACCCAGCCCAATTCCACTGATTGCCTGTTGAATGTCACCATGAATGCTGACTTGTCCGGGCTGTA
TTGCCGGACCTTGCATCTGTAAGGCGTGGCGTTGACCTTCAGCCCAATCTTGAGTGGCGGCACCCGAGCAGGTGGGTCGTCGCTAAGTTGAAGTCGCCAC
CCTCCAAACTTCTGCACTACAGCATACAGTCGACTGGTAATGTAGTCATCGACCGCCCCGCGATCGATCGCATCATGTACGAGAGCAATCACTACATTCG
GTACCGCTTCTGCAACCACCGGTTTGCTAGGTGGCATACCGCCAATTTCACTAACAGAGTCATCATCGTCAGATCCACGTGACGCAAGATACTCCAATTG
CTGGTCAATGTCAATGCCCAGCTCGGTCAGGAGAGATTTTCccgcaagaagctcatccTCGTTCGACTCGACAATTAGACAGCGTTTCGGGCTTGGCATC
TCACTGGGCCCACAGGAGTATTGAGCGTAAGCCTCACATCTACTGCTTGGGTCGAGGCCAACGTGGCGCCGCCAACAGCTTGTGATTGTACTGCCTCGCT
TAGTTCTACGAGTTGAACCGTTGGGTCCAGCCTTCGTAGTTGCTCGATGTGCTTCAGTGAAATTACATTCCAATCACATCCGCTGTCAGCACAGTATGGC
AACTCAAGCGCGCCATAGACCAAGACTGTGGCACGATCGTCAGTCGTAGAGACAACTGCACGCTCAAGTGGTTCGGCTCGAAATCGTTTGCTACCGTTGT
TGATCGCTCCTTTCTTTGTATTTCGTTCAGCCAGCAATACCTTCTTGCAGGCCTCATCCAGATCGGGGCACTAACTCAGCCAGTGATCCTTGTCGCAGTG
AAAGCACCCTGATCGTGGTTTGCTGTTCGTTGTTGGCTGCACTCTACGCATCGGTTTGGTTGCAGCCACACTGCGATGGTTTGGCTCAGTACGAGCACTT
TTGCCAAAGTTGGGGCGAACGTTGTTCGATCGTTGCCCATTGCCTTGGCCACGTTAAAACCTCCTGGTCATTTCGATGGGGTTATGATTTCGCTTAGCCA
GCATGACACGAGGCAACTCAGGATTTTCGCCTACGCACTGCCGTCACCCGATTGCTTTCGTGTGGCTTCTATGGAGTTCTATTGGGAGACAGGGGGTATG
ACTTAGCTTTAACCATGGGACGTGAGTGTCGATTGGGAGAGACATGTGATTATGGAAAGATCTGCCGCCTGGTCGCAGATGGGCCCAATTGTCTGGAAGT
GTGAATTCTGACGGTGCACACTCAGAATATCAAACATACACTATGTCCAGTCACCGGACTTTCCCTTACGACGAGTGTCTGAATTCTGACGGAAAGTGTC
TCAGAAGAACGTATCTCTGAGAACACCTCATCTTGCTGCGACTTGAGCGACGAGCATAGATCAAGTACCAACATCACGCACCCCAGCATTCACGAAAACG
TACGCAGGAGAGCCTACAAACACATACTACTATGAAAGAGATCAAGCCAAATGGGGTCAAAGAAGACCAGACGCTGAATCCTGAATTCTGACGTCTGAGT
TCCGTATGGATTCTGACTTCTGGATTCTGACTTCTGACTTCTGAGCTTTTCATGAATTAGGATTTCTGACGTCTGAGTGTCACGTGAATTCTGACTCCGG
ACGTCTGAGAGCTCCACACTGAGTCCCAGTGAATTTCAGACGATGGAACCAATACGTAATCAAGAGCGTAATCAAGAGCGTAATCAAGTCTGCAATCAAG
TGACACGCAACTTGAACTGCCGAAAAATCCAGTAGGGGTGTCGAGTCAACAATTCGACGTGTACGATCGAAGATCGCCACCCATAATCAAACCAAGTGAT
CTACCCCAAGCATAGTGAACGCAAGTGTGTTTGTGAAGCCAGTCAGTAGAGGAGAGAAGGAGAGAGAAGGAAGATAGTCAAACTTAAGCCAACAACAGAG
TTTATTTTTCCCTGTAGCGCGCAAGTGACTTCGGCCAAGCCTGTTGAGGACCCGAGACTACGACCGCGAGACGCTAAGGGCACATCGACCGCCAAAGGAC
GGCGTCGTCTGTGGAGCTCCACCAAACTCAAGTCCAGTTAGGTAGTGACCAAAGGCGCCTTGTGCAATCCTGNTTTTTCTCTCTTAGAGAGTGGTGCGCG
TTGTATACGGGTATTCAGACGGACTAGGGGGACAATGCGGGGTCCTAAcccgttgcgctcgctgtcccagctcgctAAACTTCAAGACAGGTCCCACCTT
CGCTTTGCTCGGCGGGTGCCAATCTTGAACTGTATCGTGCAAAGCTTAATCATCAAAGTACAAATGAATGATTTGCAGAGCTACGCTACCTACTCAACTC
AATCCGTAGGCGCGTTTCGTTGCACAGTCCCATGTCGGTAATCAGCGT