Description :
From Genome Similarity Track
Location :
Scaffold_668:3624- 6424
Transcript NameFunction/comments
Phypl_g10203hypothetical protein

Sequence
2800 bases(100 bases per row)
TACGTCCTCCTCCGGAATTATGTCAGCGACGGCCATTTGCGAAGTCGAGGGGCCTGCCGCCAGTTGCTCCCATCTCGTCACTTCTTCAATATCGGTGTGC
GCGGCAGGCGGCTGCTGTAGAATCGGAGTCCATGCATCCGCGAGTATATCGGCTTATTGACGCTGGTCTCTAGATGGGTTCCCTTCTATCGGGTCCAGTC
TGTGAATGGTATTGCTACTGAATTTGGTTGAGACTCTGCGGGAAAATGAGAGCGTTGATTTTCCGGTCTAGTGTGTAGCCTCCCGAAACAGCTTGCGTTT
GCCGAAAGTGGCCCGTTCTTGCGTGTATTCTGCTGTGGCTCTGCGGAGGggcgctgctcgcgtcgGTCCCGCTACTGTATCCAGCGATAGCCCATCGAAT
TGATCCGTGATAAATTCGACTGTGGGTATTAAACCCAGCAGGGTGTCCTGATTGCAGTTTGCTGTTGGATTAATCTCatcagcttctgcttcatcgTGTG
CTTCCTGGCTCGCTTGCGCGTTCGAAAATGCACAGACTGGTTTGTTTCACGACATCAGCTTTAAACATTCCCCACAGATCTGCGGCTTTTTCAGCATTAG
GTCCGGTGTCCGTTATCCGCTCCTGCAATTTGTCAATCGTAGTCAGCGTCAATGTTTTAACTGCGTTGTTGCATATTGCGGTGCAGGATGAATTCGGGAC
GGTCGTTTGAAACGAGTGTGGTCGTCTGGGGATCGCACATGTAGTTTCGCACCGTGGTGGTCTGTCGCCCCATATTGGACCGTGTTCCATTGCTGCCTGC
CACCCATGCTGCGGTTACGTACCACTGATCTAatctggacgacgccgtcccCGTCCCCGGTACTGTGTAATGATACGTGTGCGTTTCCATGTGGAGCTTA
CGGATTTTGTTAGTCGCCCATCGCGACGGTCGAGCAATTGCTACCGGGTCCAGCAGTCCCCAGTATTGCAGAAGTCGTCTCAAAGCCGGAGAATCGTGAC
TGCTGAATGCAGTTGCATAGCTCCTGTCTGCCGGATCGTCTAAGGTGCATTTAAAGTCGTCTCCAATATAGACCAAGGCCTCTGATGGGACAGGTATACT
TTGCAGTCCGTTGAAAAATGTTTCCATGTGGGTATGCGTGTCCGGCGCATAGATATTGCAAAAATAGCAAGTTTATCATCCAGTAGTCCCTTGACAGCCT
TGAACCTACTAGACCATTGTTCGTGTACATACGGTTGTACATCCTTGTATGATCCATATGGGTCAACTAGAATTGCCACCCCGCCCTTGCGGTCTGGAGT
GGGTGCCCAAAACGAGCGGTGAGGTGGATCCGTTCCTGTGTGAAAACCCCAACGCCCAGCGTACAGTTTCTGATATTTCTTCACTTCAGCCGGTGATACA
TGCGTTTCTTGAATAAGTAGGACATCGGTGCGGTCGTGCGAGTCCGTTTCTCCGAAAACCTGAAACCAGTTATCTCTCTCCATGGCAGTAGCCCCAAGTC
CGTTTACATTCTGGGTGACAATTCCGAAAGTCACGTCGTGCTTACGTCTTTCGTCGAGCTGATGCGTCCAGTTCTTAATCTTCCTCCTTCCGTAGTCGGG
CTCTATGCTGTTTGTCATTTGTGAAGAGGTTATGAACAGCCTTGTTCTTGGTGTTCTCCGATACGACTGGGAAATGTCCACGTATATCTCCTTGGTGTCG
TTTTCGGCTCTGCTCTTCAGATGAACCAACGGGTCGACCCTCATTGCTTCCTTCCTTCTCGTCTTCCCCACCGTCAGCTGCGAGCCCTCTACTTTGCACT
CGTCCTGTCGTGAATTTTTGCAGTATCTGTTCAGTTGAGGACCTCACCACCGGTTCTGACTGGTCCCTTATCACCGGTTGTTCTATCACCGAGGATCCCT
CAGTACCTTCTGTCCGCAGGAGTAGTGTACGCATCGCCCTCCTGCGATCCCCCCCACGTTTGCCCGGACGGGACTTGTGTCGCTGCACTCCAGTTGTTAT
AGTCTACAATGCCATGACACACGGACCGGATGAAGGGGAATTCCTCATACCACGTGATTCTCGCTCCTTTTGGTACGTGTCCCATTGGGGATGTCGACCA
GTCAGCTACCACGTGCGGCAGTATATGCAAAATACATCACTCCGTCTCCGACAgttcctggcgctgcgctcggcaaAGTGTGTCTGGGACCCATTGTGCT
AGCCATCGCCATCTATGCGGAGATCTAACGAGCGATTGTGCCGTGAGGCTATGGACAGTGGTATCTTCACACGCTCTAACCCAATCCGAGCAATAGGGTC
TTGTGTCCTCGCGAGTCGATGGGTCCGCTACTATACGTTGTAGTGCTCCAATCTGCTCCAGATACACTTCGTGTGCCCCCCAGCTAACGAGATGGTCGGT
GTGCCAGTTCTTGGCTTCTTGTTCTGGGTATGGAAAGAACGCAAATAGATGCCTTAATGCGGTCGGGTTGGCGACCAGCCATTCTCGGATCTCCGCGATT
TTAGCGTTGCGGCGTTTCGCATCCGGGGTATGTAGTGTGCCCCTGTGCATACTGTACCAGTGTTTGAAAGCCTCCCGGTTGGCAGTCATCACTAGTTTCA
CCAGTGGCTTGTCTAACTCATCCATCGGAGCTTCCGTCGAGTCTCTCAGGATTCGGAAATATGTATTAACCATCGCATCTCCAGTTACTATTCGTGCATG
CCTTAGATGTAGGTTTTCATCAGCCCTTGTGGGCTCTGCATCCTCTGGGTGCGATGCTGCATACCTGTCGATACCGTATGCCTAGTGAATGTTCCGCTCC