Description :
From Genome Similarity Track
Location :
Scaffold_15:362347- 363773
Sequence
1426 bases(100 bases per row)
TTGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTCAATTAGAGTTAATTATACTCGGG
CCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAAT
GTAATATTCTAAACTAGGAATCTGCCAACCAGCCGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAAAGGTGCTGCTCTCAACCAATAGG
AATCCTAAGTCTCTATGGACCACCCGTCGTGGTGATCCTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGACGAGAAAGTCTTTCGAACCTCTAAC
AGACGTCGTGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTGGGTGTGTAACCCTGTTACCCCCCCCCCCCCCCCTCTCAAGGTTAGACGCGCCGAGTC
ACGGCACGTCAATCAGGAAATTGACCACTCGTCAATTCTCCACGTTGGGAGAAGGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGAAGCAGACCGCC
GCTACAGCAGAGGGGAAGGCCTCCACCGGGACAGAGACTCTCTCTGTCCCCGAGTACTTCGAGCGTCAGAAAGCAAAGCGCGACGCTCTTGCTGCCAAGG
TTGCGGCGGGGACAACTCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTACGGGGATGACGACGTGGAGATGGAAGAGGG
CGAGGCCTCTTCCAACAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGCGACGACTCGGACGCT
TCAAGCTCGAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCTCTGCTGCTGTGGCTTTAAGCTCCCCGCGTGAGGTGGCGCCTTCAAGCTCTCCGCGCG
CTGCTCAGGCAGCGCGTGATCCGTGGATGCCGTCTGCGTCAGAGATCACAGACCGTGTGGGTGTGGGCAACACCGTGCCTCCAAATGAAATCCCGCTGTA
CGTATGCAGCGGTATTCACGACGATGCTGTTGCGGAGCAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCACGAG
CTCCGGTACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAATGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACA
AGAAACCGGCTGCTTACCGCGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGCGCGGCTGGAGCAGCTCCACAGATCCTCTGT
GGACGCTGGTATTCCATGCGCTGTGC