Description :
From Genome Similarity Track
Location :
Scaffold_28:362278- 363944
Transcript NameFunction/comments
Phyra_78057secreted RxLR effector peptide protein, putative

Sequence
1666 bases(100 bases per row)
AGTGCAAGCCGAACAGTTCGAGCGCTGGATGGCCGGCGGAAAAACTACAGATGGTGTTTTCACGTTTTTGGCACTCGACAAAGCTGGAGACAAGCTGCTC
GGGAGCCCTCTTTTGAACACTTTCACCAAGTACATGAACATTTACAACAAGCGGAACCCCGACCAGGAGACCACTTTGATTGGGACGCTAACGACTCACT
ACGGAGATGTTGGTCTATCCAAGCTCCTCGCGGCGGGAAGAAATGTCCCGAGCACGTCGAACCTCGCCACAAACTTGGATGCTGCGCAGTACAAACTCTG
GATGAGCCAACGGAAAGAACCGGCAGACGTCTTCATGATGTTAGGTCTGCAGAAGGCTGGCAAGAATCTTCTGTCGAGTCCGCTATTCACCACGTTTACC
AAGTTCACGGACGCCTACCACGCCAAGAACCTTGGCATCAAGATGACTACGAATTGGATCGTGAGGGCCCACTATAGCGATTTTGACGTCGCTAAAATGA
TCCTTGCAGCGGAGAAAATACCAAGTGCGCAGAGTGCTGGAAAACGAATGGAGGCTGTACTATTCAAAGACTGGATGCAGTCTCCGGATGACGCCTTCAG
GTCACTCAAACTGGATCAGATAAAGCCCTCAAAGCTGTTCAAAAACCCGATGTTCGCATATTGGATGAAGTTCATGGATGATTTCCACAAGTCTTTACCT
GGTAAGATTGTTCCTCGGACCGTATTGTCGAGTATCTACAAGGACGAAGATTTGGTAAAGGCCATTACAGCGGCACAAAAGAACCCGAAAACGAAGGATC
TTGCAAACAAGTTGGAGACTGAGGTGCTCACGTAGTTCATCTTCGCAAAAAAGGACCCGGTCGCTGTTGCCAAACTGTTCCACGTGAAAGAAAACACGGA
TGCGAACTGGAAACTTTGGAAGAAGTACGTGGAGGACTACAACAAGTACCACCTGCGAGGGATCACAACCTAAATCGCCCACAGAGTTGTGAAAGACCCT
ACCGGTGGTAGATACACGTCAGTTGTAAACTGCTTACTGCGGCATTTCTCTTTTTGAGCATTAACGAGTTTCCGACCATTTGTGAGTCTCTTGCAGTTTT
CGTTTCAATCGACGCGGCCAAAACCTGCCCTACAAATCACACGAGGCCGGGAAATCACTTGAACTTACTAATTTGAAATTCGACGAAGCACCTCGTCACA
GTATGAAAATTGTATTTGTCGGTGTTGAATCGGGAAGTTTGGCCGGGGCTCACATGATTTGCCTCAACTACACGTCGGTGTATTTTCGAAATTTAGAGAC
TAAGGAAGGTTCCTTATTATTTGGGGGCTACGTTTCTCTATACTACTTCTTAACACTAAATGACCGAGAAAACCGTACCGATTTTCGGCACTTTCTTAAG
GCCATATTCGCCAATATTAGTTAAAGTCAGATTTGAGCGGCGCAAGATACTGTTGAGACTTACCATAGAGATACAATGAGCTAGAGAATGCTCCTGTTTA
AGTGCCTGTTTGTCCGCCACTGTTGTAAGTCTAGGTCGATCTCCACCATAGACACGAACATTTGCATCATTTGGCCGCCACCTTAAACAGAAACGCAAAC
ATATTCAAACAACGTGGATTACATATCCTTGAACAACGGTGCTTCATCTCACTAAACACAGGAGAC