Description :
From Genome Similarity Track
Location :
scaffold_7:36225- 41756
Sequence
5531 bases(100 bases per row)
GACAATGTATTGAAGCCTCGCAAGTATAAACCCTGATGAGGGCATGTACTGCCGGAGTGCGTGATAGCTATCTCATTGGGCACTTTTGCTTTATGCGCAG
AACGGCGCCACAGCCCAGCAGTTTCAGCGCGGCATTATGTACATTGTTAATCAATAAGTTAGGTATTAGTGTCATACGTAAAGCTTTGCACGTATTAAAT
TGATACCTCGCTGGAAGAATTATTGCTCGGCTCAATTGTCTTGAGCATTGAAAAGAGAAGTACCACGCTGGAATAAGGGTTGTAGACATCGAACACTTTG
GCGGGACTATATTATGATAAATTGGTTGGCAAGAAAGCTCTATATGATAGAACTATGATAACTTTAGGAAAGTCATCGGGAAATATCGATGCACTTAACG
TCTTTGCAAAAAGTATTTCGgcttattttttttacatgTAACACGACCAGTTTATGTCTTCTTTGAATGTTTAGGCATTGgcagatgccatagccatctc
ggcctctcttacccagagcagagaATTCTCTCCACCCTTACCCTTGAaggccttaacgctcaccatgagcggcctgggctgggaggagtcatccgtcgtc
gacggtttctgctgtaggtgctctagcagagcattttcagtgCTCGAAAACGTctttaggcgcgcgcttatcgcctcgGGACTTTGCAAATCAAGTTTCT
CCAAGCCCTCAGGAACATgctcgtcctgcatgccctggggcaaaaaggagtaTTGCTCCaacctcacagaggatcagtcgtaacgccTTTGGCGTAGATT
GAATACgactgctaccaagtgcagcggggctgccgtagctttttgcttagaagaagctaagccgagatcaccgaccttacgctctTTGCAAGAGTcagaa
cgagtgtagcggatcgcaatccggtACCTCCAAAGTACTCAAAAACCTTACCAAGGAAAATGAACTCCTTCGCTCAAAATAGAAACTAGATTTAATTGCT
TTAATTTttgcagagccgccaatatttaAATCTTATATTTTCCAaagtaatatagtaataccaaaTTAATGctgtaaaacctaattaatgtgcattacta
ctggcagtcctgccacgtagtggcttcttgttactgtgtagccacaccattgtgtgattacaccaacttgtgtaatacacaccaaTGttaacatcatctt
gtgtaacccaccctttcatacaagggtacgtgtaaccccattacagcGCTGATCTTAATAAAAATTAGTTGCTTAGCACTTTCAACCTTCAATGAACTCC
GCAGCTTGGAATGGATAatctcagcagctgaaaagtTTATCTCGACTCGGCACTTGACAAAGCCAAAGGACAAACCTTGAGGGTAATATTCTGGAGGGCA
ATTTTCTGAAGTAATGGATAGCGGATTCAATCGATTAGCCAGTATGGGAAAACAGTCTTAGACTGCTTTCACAACATTTTGAGCCAGAAGTCGTTCTTCT
CACGGTCCTTATATGCGCTGACCTGGAATTAGACGTATTCAGTATATATTGCCTCGCGTGCTTCGTCTGCAAACAAATCAAACAAAGAGTCTTTGACAAC
TTTCCTTTCTTTCATAGTCACTACATCTCCCGGATAGCGTGGATCCAGAAAATAGGCTCTTCACATCCCGTTGCCGTACAATAAATCATTTTGCGCTTGG
ATCAATTCCAGTGTTCTCATGAGTATTCAAATATGCTGACGTCCAAATTATTGTTGAATATCGAATTTTAATGCGCGGTACAACTCAGAGACATGTACGG
AATTACAATACTTGCGTTGCCAATCAGCTTAAAGCAATACGCGGTAACACAAGAAATTTGCATCGGTAATGATATTGAGCTCCTTCTGAGCACTTGCTTT
CATCTTGGCTGTGCCTAAATAGGAACCTTAAGTTAAACAATACTCTAGAAAATAAATATACTTTTTTTGCACTCTGAGCCTGTAGGCTGTCCCATTTTGT
GGCGGAAGGTTGAATGCTGGCACTTTCTGTCTTGTTTGTTCTTTTCCAAGCTTTGCCTAGATAAAGTGGTGATACGAAAAGAACGATACGACTTATAAGC
AAAAGCGAATGGAAGATTATACTCGAATGTTTAATCATCAGGATAGTCGGCGACAGCTCTTCCTCGCTTGGTTTTGCTGGCTGCAAATGCCCTTCACAAG
TAGATGCAGGCCGTGGCCCGCACACCCTTGTAAGAACAAACCAAGATACTTTGACTGCAACAAATTCCATGCCAATTTGTTATTAAAAGTATTATTGGAT
ACTGCTTCACTAAAAGAAAGATCAAGAGCTGTTTGGATTTCAGTGACACGGCCAAGATCGCTAACAATTAATTGAGTCGTTTGGCCCTGCTTTTGTGTAC
AGATAATCTTCAGAATCTACGACATCTACTGAGAAATAGTTAAATTTGGGTTATTTTGTATGCTGACCACCCCTGTAGTCAACTAAAAATATGTTGTGTT
GGAGGCCTGCGACTATTTGGACCTGCAAGTTTGTTTCGATCAGGGAGAGCCACATCTGAACGACATGGTTGCAACACGtttcaaaaaatttcttcttcaa
cGCGCTGAAAAGATGATTCCGTGATGTAGTGGTCCATGGTAATTAGTTGACCGGTCATTTCTTGCTCCTTTTTCGAGAGATCCGGTGTGTAAAATAGACT
GACTGTTGTTTGTCGAGTGATTTATGATTTTTTCTCATTGCTTTTTCTGCGTCGAGCGCGACGTGACAAACCATTTGGAGCGCTCATCATCTAAGTAACA
TCATGGACTTGAAAAACGGTTTACATTTACTCAAATGAGCTCTGATACATTTCGATATGCGCCGATAAGTGACGCAGGCTTTGCAGTGTTCACAGGTAGA
AGACTGTGCTTTCCGTTGTTGCAAAGAGTCAGTAAATAAACTCCAAACGTCATCGACTATTCCTTCTTCCCATTTCCTTGACTGCTGCAGCATCAACGCA
CTTCTCAGCAACATCAACGGGAACGTCTGCTTGGTCGGAGTCTGTcattgctcaagccgttaaTCGGGTACCAGATTACCAGCCGCTGTGATGATGGAAA
GATAACACAAAACAAGAAGAATATGGCAGAGAACAGATTATTAAGTCCGCGACGGACCTGCGTTTGACATGGAATCCGTAAAAACCCAACTTTCCCATAA
AAAGGAGAAACGGATTTTGTGATAAACCCCCTCAAACGCAAATCCAAAAAATCAACCTGCCACTTCTGTCGGGTACAacatttttcaaattcaaCACATA
TGTTTCGAGCAAGTAAAAATACAATCATTAAGATGGTTTCATTCCTAATCTCAGTAGTCATTTAATGTCTTCATCTTGGGAATTCTATTTTTTCACATAA
ACAAATGATACGCACAAATTAGATTTTAGTCTTAGAATATGTTAGAATCTTTATAGGGTTGTGCGGCAAAGCACTATATACTTCATGTGGTACAGATTGC
GAGTCGGTGGTTTCAAGTCGAGTGTAATCACTGTtttctctctatagaggcaCTACGTCttatcgagaccagtggaatatgcactcggcgtcgtccagtg
tctccaCTCCCTGTcccgggacgtcggttcaacGAGCCTTTACACGCCTTGCACAGGGCACAGTACGTCCGAAGGCGACGAGTGTCTCCATAAACACCAT
caggtgtttacacgctgctcagaagctcggagctctccctcctctttttcatagctgagatccattggcttaggcccgctcgacgagctctgagggaggg
tgtgcattccaaccaagtcgtgccaacttgaagctgaattcggcattcaatgccacgttcaccgctttttcaaaagaaggcgGATGCGCACAGAAGGCTT
CCATTCTAGCCATACCAGAGCGGGGGGtattccataaagacggtcactgcgactgcCTCGGGAAGAGGCTTTGCTGTGTTCCCGACAAGGAGAGTTCTAA
ACTCCTGGACAAAtttcaccaactccttcttgccttgtCGGGCCGCAAGGAAACGCTATCGCACGCGAGATGCCttattaggcggcgagaacacccgcaa
aagctgatgctTCTGCTCCTTCCTGGAGGGGagcttcaaccaaagcactacacgttagtgcccattctcgcgctccgCTCCcgagctagcgccacgcgct
gtcgcTCGCTCTTGAGCATCTTGACACGATTGGCACTTTCAGAATATGGCGGCTATCTTTTTCGATGGTTGTACTACATAGGCTGCGtgcttgatgaaga
aaatgaaaatcAATCATTTGATGGTGTCATGCTTATAAGTTTCAAGAGAATTAAAAATAGTTGAAGACGATTAGTTTATTTAAAACGTCGTCGCAGACTG
AGTTCAATCTTATCTTATTTTTGGTCAGAACATGTCAGCGTGAGAACAGCGGATCGGTAGAGGATTATTCTATGAAAACGGCCGCTACGATGCTCGTGTA
ATGATGCGTCCAGTTCAAGAATAATGTGACTTTTGCCTTAAAACGTTACTGCTCTGTTGACAACTCCGCTGGATTCGCACCTATAACTTCTAGCTCTACA
GCTATtgtgacggggcacacggcaccttgcacagaggaagcttgacttccaagagtatacNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCGAGAACCGGGGTGGCCTTTATCCGGTATGGGGCTACCCGTGG
GTTCTGCCCAAGAACTGTCTAAGCTGGAACG