Description :
From Genome Similarity Track
Location :
Scaffold_439:36214- 38916
Sequence
2702 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGTAACACTAAGTCACCAATCTCAA
ATATACTTAAGTTTCATCTTCCTTGTTTGTCCGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGGTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGT
TGAGCGCAAACTCAACAGCTGGAAGCTGCGTCGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGATTTCCAAAACGCAGCAGTGAACCGCGGG
TCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTTACAGTGACTAGAACTG
GAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATAGTCAAGACTCATCG
ACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCCGACATGTTTCGCATGTCTTGACGTATCA
GGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCCGGAGGGCGCGTCATGCGCC
TCCGAGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCTGATGATAGAGGAGGCCCTCCTTCAACT
TATATCGGTGGAGCCGTGGGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATC
GTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGCCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGTGTCCGCAAGC
ACGTTGAGCTTGCCAGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCG
CCGTCCTCAAGGACGCGTGATTTGTGTAGATCACGAAGGGCCGAGAGCCCAGAAGGTGAACGCGAAACTTCGCAAGGGCATATTTCATTGCCAGGAGCTC
CTTGTCGTGGCCAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGTCTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGTAATGCA
CATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCATCCGGCAGGGTCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGC
TGTCAGAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGAAGGCTCGGCAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTA
CTTGTGAAGGAAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGGTCGGGGCGTTTGCCATGCTTCGATGGCCTTGACCTTTTCTGGGTCAGCC
TGAACGCCCACATGCAGACGAAGCAGCCACAAACCTTGATATATGGTGATGCGAAGACGCACTTGTCGATGTTGGTGTAGATCTTGTTCGCTCGCATCAC
GTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGAACGAAAATGTCGTCGAAGTACGTCTGTACG
AAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGC
CGCTTGGAGTGCTAACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCC
GGTCATGTTGTTTAACAACACATCCTTTCGTGAGATTGGTGTTTGAGCCGGCACCGTCGCGTTGTTTAGCTTGTTATAAGCGTGAACCAGACGCCACTTT
CCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGACGAAGAAGGCATCAATGA
CTTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGTCTCGATCCGGTGGGAG
TT