Description :
From Genome Similarity Track
Location :
Scaffold_11:362101- 369102
Transcript NameFunction/comments
g4122.t1hypothetical protein
g4123.t1RAW41491.1 hypothetical protein PC110_g2324 [Phytophthora cactorum

Sequence
7001 bases(100 bases per row)
ATGAAATCAATATCTGGTTTCAGTACCCGCGTATCACTGGCGCCCAAGTTTAGGTGCTGAGATGTAGATGCAGCACTACCCGGAGGCAAGCGTACACCGT
CCGTGAGAACGACGGTGCCATCAGCCTCGACATGATCCAGCCCGGCCTGCTTCTGTCGGTTGTTAGGCTGGACGCCACAGTCAGAATCGGCTTCAGCCAC
ATAATTCTGGGAAGAAACAATGACACCTGCAGCACCATTATTTGCGAGCTCTCTCGAAATCTCTCCACCCGATGGCCCGCGTCCAATAATTAGGACCGTC
TTTCACAAAAATAATACTATCCCGTTAGAGCGTTTTGATCAAGCATAACGGCACGCAATACAAGCTATACCTTATTGGCGTATCGCTCCGGGGATCTGTA
GGACTTTGAGTGCACTTTAGTACCTCGAAAGTTCTCGATCCCTTTCACAGTAGCGCAAAATGGTTCTGAGAAGTGGCCGTTGCACACCACCACCCTGTCC
ACTTGCTCCTCGTATTCACCTCGTTCTGTCGATGACACGCAAATTCTCCATGCCGCACCGCCATCTCCACTCTTTCGCACGCTCGTCACACTGGAATTCA
GTCGGGTCACGTCGGTGACCTTGAAGTGCTCTGCGTAACTTTTGATGTACCTAAGCACGTCCACGTGGGAAGGATAACTGGGCACGTCCGCAGGAAAAGG
GAACCCTTTAAACTGCATCACCGCAGTCGGCAAGTTTGTACGCAGCGACTACAAATAATTCAAACAGCCACAACCATTATTACACGTATCGAGGGTCTCA
GCTTGCTAAAAGTTAACCTTGTAAGTGCAGCTGTCGGCTGTGATATCCTCGTTGTATTTCCAGACGCCCCCCACACTATGGCTCTTCTCGAATACAATGA
CCGAGTGGCCTTCATCTCTCAGACACTTGGCAGCGACAATCCCAGCGGCGCCCCCACCAATCACAGCCACATGCAGCAACACCATTTCGGCTAAAGATTC
CGAACTGAAGGGTCTTTACAGATATTTTTGCGGACTCAGATTTCGGACTCAGAAATTATGGTGTGTGATCTACGATTTTTACATGGAGACGAGTTGTGCG
GTGCGGCTGTGTATCGCGCAGCTCCATAGCGCGGCGGTGACACTCGATGCGCAGACGCGCAGATACCGAGTGGCTCACGCGAATTTCAGTCGCGTTCAGG
TGGTGGGCGTGTGTGTGAAGAGTAACGAGGCCCAGCTCAAGCTTGGTCAGGAAATAACACAGTAAATCGCATTATGTTGCTTCAGATAATACTAACTCTG
TGTATGCTGCAGACGATGGCTCGGGGTTGCTGAATGTGGAGGTGATGCCAAATGTTAGAGATGGCCAGCAGGAAATTCCACTGGGGGCTTTGGTGGGTAC
CATTTTTTGAGATTGAAATAATGAAAAATGGTCTGGCTAATAGGGATTGTTGTGGATGCAGGTGGAGTGCGTTGGAGGCATTGAGGAGCCGTGGCCACCC
TCAGATATGACGCGCAGTCGACGCTGGATGAATGCAACCCAGTAAGCCACCTCATGGAGCTGAAATTCGCCTGTACTGTAATTTTACTGATGGAATCTGT
TGTGAAGAGTCCGTGAAATGCAGGATCAAAACGTGGAGACGCTAAGAATGCTCGAGGTTATGCATCTGTACGTGTTGGTGGCCTTACGTGAACGGGGATG
ATGCTTACATCTGCTTTGTTAAAGCTACAAAAACGACTACGCCGTTTCCCACCCAGCATCACCAGCTGCACTTGAACTGCTCGCATTCCCGCCTATCGAC
AATGGCAACGCAGTACGGAATCCAACACCAAATTTGGAGGATAATCCTGTTGTTATTCAGCAGAACACAAATGGTCATCAAGTCAACCAGTGTGGGAGAA
CTAGCACTCTAATTGAGAAGCCCTGGGAACAACAAAGCGTCGGCGCTTTTCATTCGGATACTGGGGTACCTCCTGCGGATTATCAGTTCGCGCTTTTGGA
GAGAGACCACACGTTGATCGAACAAGGAGCAAAGTCACTAGAGATTCGGTACGCACGTTTTTACTCGAAAGGCTCAAACGAGGTATGCTAACAGTCACTG
TTGCGTTGTTGATGCAGACTTAACGTCGCTCCTTACTCTATCATTCGCGTGAATGACCGCATCACGATCAACAGCAAAACATTAACCACAGTGACAGCAG
TCCGCAAATATTCACGGCTGCAATCCATACTTGAAGCTGAAAATGTAAATGCGCTGCTTCCGCAGAGCTCGTTTGTCGGGGCAGGAATCTTCAATGCTTC
AGCTGAGGCTGGGCGTTATTTTCGACAGTTCTTCAGCAATGAGGAGGAAGCACAGTATGGACTTGTCGTGTTTGAACTGGCTGTGTCTCGTCCTGCTTCA
ACTGCTCCAAAGTCGAAGGAAGAATGGAGCAGTAAGTCGTTTACTGACTTGTGGCTGAGGTTTAAACCTTCTAAGTTTTGTCCCTTTGTTTCGTGGTACA
GCTCTGGTTTATCGCCAGTTGGAAGCGAAACGTGAGCTCGGGTGTTCCATTGCAGACTTGCGCTTTAGTTTTCCCACTCTGCCAGCTGAACTGATCACGG
AGATCCTTACGAATGTAAGGTTGGTGCTATCGAAATGACCTAGAGATGATTTTTACTGACTGCTGCTTGTGTATTATTACAGCTGCAATATGATGCCTTG
GTTGTTCATATCAACGGCACATATCGCCTAGTCTGATGAAGTTGCAGTGGTTGTTGCTACTACCTGGGCAGCTGAACCCTCTGTGTTGCATCGACTTTAT
TTTTTTAATGTTAGTTTGAATGCCGATTCTGGATCCACGGATGTTTAGCTGCGTCTTCAAGGCTAATTCGTTCTTTAGGATTTCGCTTGAGTAGCCCAGC
GATAAATGCTTTAGCCGTTTCAGAAACTTGTGGGCTTGGTGGGAACTGGTAATCAACCATCTCGATTCGCCTGTACATGTCATGTTGATCTTCGCAATAG
AAAGGCGTCGAGCCAACCAGCAACTCAAACGTGAGCACACCAAGACTCCACGAGTCAGTCCGAAAATCGTGTGGTTCTCCGAGGATCATTTCGGGGCTCA
AATAATCCGGAGTACCGCATAAGGTCTTTCGCATGTTGTACGGCTTCGGCGCGTAAACTGACCAACCGAAATCAGCAAGCTTTATGGTTTGATTGAATCC
TAGCAGCAAATTTTCAGGCTACAATGAACAATCAGCGTCTCACAAGAATTCACCCACACATCGTCCATAATGATCAAGCTTACCTTGATGTCTCGGTGAA
TCACGTTGCAACAGTGGCAGTATTTCAGCGCTTCAACAACTTGACCCACGTAGTGCGCTGCAACGGCATCGGCGAAAAATTTCTCTCTTGCGAGCTCTTT
GTAGAGTTCACCGTATGGCGCGTATTCGAGCACTAGGTATACACACGAGTCGTCGTAGAAGTAACCATGCATGCGTAGAATATTCGGGTGGTGGAGCCGC
CCTTGGATCTCGACCTCACGCTTTAGATTACAAACGCCGCCGTCACGCGTTAGAGGCGACTTAAATAAAACCTGTCACGAACATTTCGTCAGTAACAGGT
GTCAGCACAAAGCTGCAAGATTAGTCCCTACCTTGAGAGCGACTGTGACATTCGAGCACTTCTCTTTCGCTAAGTAGACATTCCCGAACTTGCCTTGACC
GAGATTCTTCGTCACGATGAAATCGTCCAATTCCCATTTCGGGTTTCCTTGTAGTCGTTCGCTGAGTGACGGAGTAGGTTTTGAAGCATCAAGTGACAAG
CGACTCGAAATGCTCTTTCGTGGAGCCTTGGTTTCGAAGGCAGTAGTTGCCTGAGGTACTGAATCAACACGAGCCCGAGCCGGAAAAACAAGCTTCCGCT
CGGGCCGCGGGCTAGCCACTTCAGGCGTTTCATCATCGCCATTGTTCGTGGATAACACTCGCACACGTAAAAGCTGCTGTAGCTCCTCCTTACCGTCCTC
GACATGATTCACCATGGTCGTCTCTGTCTCCAACTGCACCAGATCCGCATCACTGGTTGTACCGCTCTCCCTCCGTGCCGCAGTACTCGGCACACGAAGA
GCCACGCCAATACTTTCTATTGTTGCTGTTTTTCTCGAGTTCTCATCTCCTTCCTCTTTTACGCCCCCTCCTTGTAACTTTCCGCGCGACGTCACTGTGT
CATTTCCCTGTTGTCTCTGTCGAGTCGCCAGCACACTCACACGCCTCGGCCCCGCAGGGATTTCCGGGGTCGGGCCGTCAATGTCTCCATCCATGCCTCC
ATCATCACTCTCGTGCTGTAGCAGCCGCGTGGGCGTCAGTACTCGTTGTGCACCACCAGCCAGGGACGGAACGTTCGAGCCCGGCGAAATATAGCTCCTG
CGTCGCTTTTTACGCTGCTTAGCGGTCAGAACGTCCGCCTGTGAATCTTCAGTTGTTGCTGGACTGCTGCTGTCCGTTGTAGATGCTGGTGTCTTGATAG
TCTCATGAGGTTCCTGCTCTTGCGTCTCCTGGGACGTCTCCAGCTCTCGGATCGGCACGAGCGGTGTCACAAGACCCGCTGATTCGTAGGACACACGACG
CGCTGCCACTGGCGTCGACGGTGGCACTTTACGCTCGACACGCACTGCAGGTGCCCGCATGGGGGCTGCTTTTGCCGATCTAGGAAGAGGAAAATACATT
GGAGACGGTGAGACTTGATCTGCTTATTGTCGCGTGCCTGTGCAGAGCCTCTCTACCTGTGGGTGATAACGCGCCGAGCGGGGCGAGAGACCCTGGCGCC
CTCCTGATCCTGCTGCTCCTTCTGACGACGCTTCTCCGCGAGCCATTTCTCCAGTGCCAGCCGCCGAATCTCCGCCATTTAGCGTTGAGGAATATTGATA
CAACTTTGAATGTTGCTTTACCGCGCTTTTTCTCAAATTTAGGAAAAGTATTTTTGTGAGTGGTACAAAAGTCGGTCTATTTTCGAGAAGGCTTGCCCTC
GGTCTCGGACAGGTGATCTGCTATTTCCGCACCCTGATTCTTGTCGGATGTGAAAACACGGTCAAAGCCGACTTCCTTCAGCTTCGATGCATGCGACTGT
GCTCAAAGTGTGGCTTTAGTATTGGAATGCTTAATGGTTAACGATCGTCTGGTATTTTTGACATGCACGTTTCGGACCGACAATTTTTTATGCGATGAAG
CAAATGACTGCGTGGACCTCTGCGCATCCAGGAATGACCGGCGTAGCGGGTCCTACCACCACTTCACAATTTGAAGCAACCAAGCTGAAGCCGACCACAA
GAGCTCGCGTCTCTAAGTTTTAGAAAGAAGCGGCTAAATCGGTCGACCACGCACAATGAAATCGAACGGGAGCATGAAGGTCGCCCCTACTGTCAGCATC
GGTCGCTACTTTTCATCATCCAGGAAAAAGTCCAAGGTGTACTGCATAGATGGCGAGTACGCCGACAACGGGATAACCAGCGACGAAGTTGGGACACTCT
TCTCCGCGAGGAGATTGCTGCTGGGAGTGTGGATGTGTGTGGGGCTCGTGCCTTTGCTCCTGCAAGCCAGAAGCTACATCAAGTTCGTGACGCCCCACAA
GATTTCCCAGACGTTGGTCGTTCCGGCCGAGACCGAAATCGAGAGGGCGAATCTCGACGAGCTTTGCCCAGTGGAAGGATTGATGGTAGCTGGGGCGTGG
TGGAATGTTGGGGTCACGCACTACTACACTGTTCCGCATGGGCGAATCTGTCATTTCGTTGTGACGCAGTACAACATCCATGGAGCGTACGTTTTGAAAT
CCGAAAGAACCGCTCCATCTTCCACAACACCAGTAAGCTGTTCTGGGGAGAGCTACCCGTTCCAACATTACTTTTACCATGGAAGCATAGGTTATTACGG
ATTCTATGAGGAGGCGTCGGGAACGTACTGCGCTAATGACCAGACGGCATATGTGCTTGTGAACGGGCTTGGGACGTACGACAGCAATGGTGCAGCATTG
GCGAATGATACCGGGGACACTTCGTACAGACGATCATACTGGTATGGCTTGTTTGGAGCTGTTTGGATTGCATACCGCTCGATCCTGATGCGGAGGAGCT
ACATCTCGTGCAAACGCTACGGAAGGAGGTGCGACAACATGCAAGTGAAAATTCGGTTCAAGGACGCAGTTGTGTACGCCCAAGAGAGTTTGCGGTTATC
AGCGCACGGGGCGAGAAACTATCACCGCACGGTGCTGCTATATCTCCTGGTCGAGGGTCTAATGAGCGACCTGTTCATGTTAATCGCCCAGGACGGATTC
TTAGCGAAAGTGCAGTATATTTCGCTGGGGTACAACTTGTCGGGCGTGCTGTCGATGCTTTTCGAGATGGTCGAAAGTATGAATTGGCTAGGGGAGAAGG
TGCGCTGTTTTATCAAGCGACTTCTGTTCAACTACGAGACAGCCTTGATGGGGGAGCTTTTGTGTGCGGTAGTGATGCAGTATTACCTCACGTCGCTAAA
CCGATCCAGTCTCCAGCGGACAAAGTCTGCAGCAGAAGCAGTCTCTTACTACGTGTGGAGCTTGGTGGGGCACGGCATTATCGTACTTGGCATTGTGGCT
GCAATCACATCTGTGCGGGCACTTGGGGCTATCATCACCGTACGATGGACGTTCGGCTCTTTCAAACTTCTTACGGCTCCGTGCTGTGTCGACGCAACAC
TAGGTGTGCGGGCCAAGATGATATTACTGGGCGGCTACGTCTGGGAGGACGACATGCTCCGATACAAGATAGAAACGCTTAAATCCTTCGGGGTTTTAAA
TATGCTGGACGAAGACGGTGTTCACTTCCTAGTTCTTAGCAAGCTCCACTGGCTTTCGATTCCGCGGCAAGATATGATAGTGATCGGAGAAGTTCACGGG
CAAAGGGTGACACCATGCCCTGAACGACCGTGCACTGGTATCGTGAGTGTTTTCGGGAAATCACTAGGAGGCCCGGCAGTAGAAAGCAACTCTAGTGATC
T