Description :
From Genome Similarity Track
Location :
Scaffold_16:3621- 6071
Transcript NameFunction/comments
Phypl_g704hypothetical protein

Sequence
2450 bases(100 bases per row)
CATGCTAATGGCCTTgacaagcagcaggttgTCAGCCTCCGCCCGCACGAGTTGGCTCTTGAGTCTGGATTGGTCTGCTCGGAGGATACTGAGCTGACCA
CGATCGCTGAGCGACTGGGACTTGACCATGACTTCCTCACATTCGTCATGGTCTGGAGTTAAACTTGCTTTAGGTGAAGACGAGTTcagcacacgctgca
ggTCCTTAGAGCGACGCTCTCGGCGATAGCGCGCGAattccttctccaccaactcgagctcgttTGTCTTTTCGGCGATCGCTtggtccttctcgtcgag
cACCTTCTgccacttggccagcttcttcttccagtcgaCCACCAACTTGCTAACGTCTTTCGtgttgcgctcgctggattCAAGTTTACCCTTGACCTGC
TGATGGCGCTTTTGAAGCTCAGTCTTCGACTGAATGAGCTGTTCGCGTTCTTCCAGCACGTCACGAAGCTTGGTTTCCATGTCTGTAGCCTTGCGCTCGA
TCAATGCGTAGTACTTCCGCCAGTTTTTGCTTTGCTTGAACAGCTTGATGAACTTGTgcggagctcgagctcgaacgCGATCACGGCATTTGCGAAGCAT
CTCGAAGACGATCTGCTCCACTGAAACAAAATAACGCCAGGACCAACAACACAGTAAGGACCTGGGCCGTCAAATCAAAACAAGGTTCGCTGCAAGCTCA
GCCAACGCACCATAGAAGCAGCAAGCCTTGCTGTAGAGCAGCGTTTGGGTGACAAGAACTCGCAGATCGCCTGGAGAAAGCTTTGAAGTGGGGAAAGCCA
CTTGCAGGATGCCGTATACTGCACCTGAACAAGTAACAACACAGTCAGAAGTCAGCTTGGCATGAGGGAGCTTTAAACAAGTGTCGAAGCTTTACGCACC
ATCCGTGGAGACCAGTGCGGACGACATCATACCAACCGTTGGCTTTGGGTGTTGCGAATTAGGCCGAGAAATTGGCATCATCAAGGCTGTCGAGGGATCG
TCCTGCCGCAAGGCGCTCATGACAAACTGATCAACCATAGGATGGAAGCGCGGGTCCGCTGCTACATCGGTGATGATGAGGGTTGATCCACTCGACAGTG
TGCTACCAGCAATGCCCAGAGATGCTGGTACTTGGATGAGTTGATTCTCCTCACGTTGTGTCCAaagctcgttgctgctgggatCAAAGAGGAAGAGAAC
CGCAGCACTGCCGTGCAGTATTTGCGCAAAtgtgctggccacgctgaCAAACAGTTCTTTCACGGTCGTCGGCTGGAACAATCGACGGATGAGCGTCTGT
AGCGCTTGGAAGGATGCCCCAGCAGTCAACTGCTCTTCTGTAGTCGCCAGAGCTCCCATTTCCTCCTGAGCTCTAGCCTCGCTCTGCTCTTTGGCCTTGG
CGAGTGCAGCTTCACTATTCATGTGCATCTCCTCGATAACTTGACGATGCTTTAGTGCGTTGTTCTTCGTTGAGTTAGCGTAGCACCGTGAAAGGAAGGC
TCTCATTTGCCGTAGGCGGTGGTGATACGCTATCCAGCACCATCTGCCGAGAGCCAATCTTCGCAAATGCGTACAAGCCGAGTCTTGTTCGATCCGAAGT
TCCGTGTGAAGTGTTGTCACCTGCTGAAGAGCAGTAAGCTCTACCGACTTGGCTTTCCAAAGCCTGAACGCAATCGATACGGGCAAGCTCCGGTTTACGC
ACGAAAGCAGACAGCGTTTAGTGAGAAAGAGCCTCAGTTTTGCTTGAATTCTGGAAAATCTCTTCCATCGACGCAGGATTGTGTGTAGATCACGCTTCCC
GCACAGCTTCTGCAGGGATTCTAGCTGTCGCCAccgcagcgtcttgaccTTCCAAAGCCAAAACGCGAACAATCGCCTCCGGCTTTGTTGAATACTAGCC
ACACGTGTAAGTGTTCGGTGCTTTCTTCGTATATCGAAGAGTTTGGATTTCCACAATGCGAACGCCTCCGATACCTCTTTAGAAACGGATCGTTTCAGCA
TGATCTTGCTCAAAGCACTCAGACAACTTAGATGTTTGCTGCGTGTTTCCTCTTGAGACGTCACTACCGAGCTCACAGCCGATGATctcgcttcagcttc
gtaAAGTTTACCTTGGAGCTCCATCAATTCAGTCGAAAGCTGCTCGACACTCGTAGATTTGCTTTGCAGTCGACGACTCGACTCGGCAATTTGGTTGGAT
AGCTCTTTTTTGTCAGTCTGCAGAGATGCTATCTGGCTCATGAACCGATATCGCCTCCATCTTGACAATGCAACCCGGCAGTAGTATCGCTTTGTTGTGG
CTTGTAAGCACATAGCAGACTTCCGTTGCAGCTTCATTGTCCGCACGGTTGAGTACCAGCAATGCCAGGAACGAGCGAGAATAGCTTGGCATTTCGTGGT
ATAACGTTGCTGTGCTTTCGCTCGAGTTGCTTGCTTGGTCTGTGCAAACT