Description :
From Genome Similarity Track
Location :
Scaffold_1149:3621- 4834
Sequence
1213 bases(100 bases per row)
TCAGCAAGCTTCAGTATCGGCGCAGACGCCAAGCTCTTCTTCACCGAGTCGAATGCAGCTTGGTGGTCCGATTTCCACTCCCAGATCACGTCCTTCTTCA
GCAGCGAGGACAGCGGCTGGATCAACCCAGCGTAATTCTTTGTGTACTTGTGCAAGTAATTGGCCATGCCAAGCCACTGACGCAACTCAGTGGGGCTTGT
CGGCGTTGGCCAAGCACAGATAGACGATACCTTCTCGGGATCCGCGCGCACACCGTTCTTGCTCACGTAGCATCCCAACACCGGAATCTCCGGTGCGCAG
AAGACACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCTGGAAGACTTGTCTCAGGTGTTTTAGATGTACGTCCACGGCACTGAGGTTGC
CCTCAGCGCGGCTGTGCACGAAGATGTCGTCGAAGTAACTCGGCGCGAAGTCTCGAAGTAGGCGAAGCACATGGGAGACCATGCGATTGAAGGTGGCAGG
CGCGTTCTTGAGGCCCTGTGGCATCACGAGCCACTCCCAGAGCATCCCGCTCGGTGTACTTACGGCGGTGAGAGGCACATCAGATGTTCTCATCAGGATC
TGATAGAATCCATCGGTCAGGTCGATGGCGCTGTAGATGACGCTGCCAGCCATGGAGTCCACTTCCGAGGGTTAGGAGTCTGCGCGGGGATGGTGGCATC
ATTCAACTTGTTGAATGCGTGAACGATACGCCATCCCCCTGTAGCTTTCTTCACACAGAACGTTGGACTGGAATGGGGAGAGGTACTCTCACGCACGTGA
CCCGCCTTTCGGCGGCCCTCGAATAAGTCATCGATTGCTTTCACTTGATCACGCGGAAGTGGCCATTGTCTGGTAACGCAGTACTTCGTACCTGGCGCGA
GGTCGATCTCATGCTGAACCCCACGATCCGCCGGTAGCTCGGCGGGGATCTCATCCGGGAAGACGTCGGCGTACTCGCAGGCGGTGTCGTATACGGGATT
CGCTGACTCCCGCAAGGCCTCCCAAGACTGCGTTTGGAATCGTTCCTCTCGAGCAGACTTAGGTTCTGCACCTAGCGGACGTGAACGTTCACTGTCCGTT
GCGACCGCATTTGCTGCCTCATCCACCGAGACTGCCTCGGCGACCAAGCATACTTGCTCGACGTCTCCAGCCTTGAGGTCCCGAAGAAAGTTCTTCCAGG
ACAAGCCTGGAAG