Description :
From Genome Similarity Track
Location :
Scaffold_17:362012- 363470
Transcript NameFunction/comments
Phyin_T30-4PITG_09849Putative uncharacterized protein

Sequence
1458 bases(100 bases per row)
CACCGAAATGAGTAATAAAGGTGAAGCCCTACCTCGTAGACGAGCTGGTTCGCGCTGGTCGGGGACTCACGGCTCTTCTCCTTCTGTGCTTCTGCTAGTT
GCTGCACCAAGACTTGGTTTTCACGGACCAGGGTCTCTCGCTCGCTAACTACTTGTAGTAGACCATGTCGCTTCTCAAGCTCCACTGCCAACTGCTTCAG
CTGCAGCATCTCGATCTAACCGATACAATCCAGATACACACACAGGGAATCTTAGTCAGAGTGGAGAATTAATTCCGCAGGAATCACCTAGTGGGTCTCA
CCTTCTTCCGCTTCACAAACCGCCGCTGGGCTTCCCGATGCTTCGCTCTTCGCTCCTCGTCCGTGGCACGTTTTGGTGTCGTCGGGCCCCCAGGCTTGGC
AATCACGAAGCTGGGCGTGACAACCGCCGACACTGGTGATGTCTTGTCTATCGTCCTATAGTGGGGTGACAGGGACCCGCCGATCATCGGGCGCGGCAAA
CCGGGTGGGAGATACCGCAGCCGACTGACGCTTGGGGCGAGCGGGTCGTCGCGTGGTGGGGGAGGCAAGAATGTTTGGCGCGAGGGGTATCGATATTGAT
TATCCTGGTCCAGCTGGTACTGTGGTGGCTGCTGCTGAGGTTGGTACTGCGAGTTCTCATTCGAATAGGCAGCCGGACGCAGCACATCGTACAGTAGCGA
GGTGTTGGCGGCGGCCGTGGTAGAAGGCGCGCCTGTGGTCGAGTACAGTGAGGCCCAGCTCGGTCGTCCTTGTATGTGGCGGTGCTCCATCAGCATTACG
GAATCTGCTTGAGGCGTTCGAGTTTGGAGTCGAGGACACGCAGCTATTATCTGGCCGATCCACGCGCGACAGCAAGTGCAATCAGGTGAGCAGATCTCTT
AGGCAAAACCAGCAAGTGACTGTTGCTTGCTAGACGCGTGCTACGAGTTTGCTGGTCGGTGCAACGGGAGGTTCGAGTCGAACTTCGACGCAGTACGTCG
CCTACGTACGAGGATGCTACTATCGAATTGGATGAGCTGATGGGATGTCGACCGCGCCGAGAATGGCTGGTCGAATCTGTGCTGGCGCTAAGTTGCTACA
GCGCCGGCACCCTGGTGAGCGGAGACTTGCCCTGGCCGGCAACGCCGTATCTCTCAGCAACAATCCAGTGATGACACCTGCGCTATGGCATACTACTAAG
TAAAAGACTACATCTGAATTTTAAAAGCGTTGCAGGATCAAGCTTATCACGAACTCGATCGGCATATTGCCTGTACAGAAGCAAGTTGAACGATCTGCTA
AATAGCCGCAAGCTAAGCCGCCTCTCTTGCACTGTTGGTAGTCGCCGGCAGCATGCTAACCAGCGCCGGGGCGCCTTGAGTTGCGTGAGGCGCAAAAGAC
GAAGAAGAGGGTGAGGTCCTCACACAGACCACGCGATGGCGAAGAGAAGCGTGGAACC