Description :
From Genome Similarity Track
Location :
Scaffold_3827:362- 1842
Sequence
1480 bases(100 bases per row)
CAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAG
ACATCGCTAGATCCAGATAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGG
ATGAGTTTTCCAGATCCGAAGTCTCTTCAACCCTGGATCTACACAGAGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCC
TACCAAGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTATGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGAGAG
TCCCGTGGGTACTGGAAGTACCATACCCCGGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATA
GTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTTCCAAGTGGATGGGAGTCGAATCCAAGATTGTGTTGGGATTGGTGAAGG
CGTGTACCGTACGAACGAGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGAC
GCCATCCTTGGGATGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCG
GACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGAATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAA
GTGGGCGGAACATGAAAGACTGTGGGTCATCCGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAAC
GTCAGCGACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGAT
CCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTT
GGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCCAAGGAAGTTGGATCCAGGACGGGGGACGAT
CCCCAGAGTCGGCCTTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAA
GCTCTCCATTGGATAAAGTGCCTGGATTCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAAACTCG