Description :
From Genome Similarity Track
Location :
Scaffold_2689:362- 1493
Transcript NameFunction/comments
Phypl_g15309hypothetical protein

Sequence
1131 bases(100 bases per row)
ATGCGGACGGACTTCCAAGACTGGGAAGATAAGCACCTTGTCCAAATTGCACTGCAGTTTGAAAGAGAGGGGATACGCATAACATGGGACTACGTCGAGC
GCCGTATGGTGAAAACGAAGAGAACAGCACGGGAGCTTCGACTACGTTTAGCTAGTCTCAAGCGGACCTACGGTAGAACAATACCCAATTTCCCGCGGTG
TTTCTTTGGTAATGCCTCCAGCCGATCGATTTGGACATCAATGCCTCGAGCAAGATTCCCACCAGGTCACGTTTCGAGGAGTCCGATGgtcgcagcgaca
gcaccaccaagTTTTGCATCGGCGCAGCCAGCGATAGCGCCATCCGAGCCGCCACTGAGTGCAACAGCGCGGTCACGAAGCTCCACACCTAAGCCGCCGg
cttcagcgacgacagcgctTGCTCCAGCAACAAGACCCACGCCGATGCCACCGGCCATAGCCGCATCAGCACTGGcaccgcgagcagcagctctgtcACG
AAGCTCCCCATCGATaccgctggcggcggcgacggcggcggcggcagaagcagcagctccagcaccatggccCACGTTCCATCCGccggcaacagcagca
tcggcaccGGCACCAAGATCCACGTTGGAGCCGCGGGCGACATTGACGGCACGGCCGCcactgacagcagcagcgccgacaccaacAAATTCACcggcga
gagcagcagcagctccgtcaccaaGGCTCAGGTCGAAGCCGCCGGCGACAGTGGTGTCAGTACAGGCACCAAgggcagcggcgccaagtcgaagacCTGC
ATCGCCGACTGTGACGGTGGATCCGAAGGCACCTCGAACGGATCGGGTTACTTGTGTCGAAGCGGTGCGCTGTTGCGGTAATATTTGGTGATATTAGTGC
GGATGCAGTGAGACAACAAGCAGGCCGAATGTACGGGAACGCTGGCGAAGTGCTTCCAGCTGGTGTCTCCGAGCTAACAGAGGCCTTGGGTCCCATGTAT
TCCAGTGACGTGTTCCTCGATGTGGGAGCGGGGATAAGCAACGCACTAGCGCAGATAGCGTTTACCACCAATGACAGGGCGTGCGTTGGAATTGAGATGC
GAGCGGAGTTATGTGCGATTGGAGAGGAGCG