Description :
From Genome Similarity Track
Location :
Scaffold_238:36192- 37337
Sequence
1145 bases(100 bases per row)
ACAACAAATAAGCAGAAACGCCATTCGAAAAGATCAGCCCCATCATTCTATGCGTACACGTGCACTACTCTATAGAAATCATCCTTGAAGCTTTCGCGGA
TCTTATGCATTCAGCGCTTTTGAATTTGAGCCCCAAAAATAATTCCTGTCTAAAACGATCATAGTATCGACTACATATAAATCATTGTCGCGTGGCTGAG
TGCAGACTCATTCAGACACGCCCCAAGCAGTTGGAAAGAGAAAAGAGTTCAACAACTGCATGTAGAAAGCCACTCTTCTCCACTTATAAGATAGGTCTTT
CTTTCATTTATGTCTTCTTTTGGAGGATTCGCGGTAATGCGAAAGCAGTTGTCGATAAGGTTGATTGCACGAAGCTTTCAATCAAAACACACGACTTCTC
ATATCTAATACTCTCATGCTTATGTTTTACCTGTACTAGCTTATAGCCACAGACATGTTTACGGCCTGTGTTCTGAAGGATGCTTAAAGCCTATTCATAG
AGTCATCATACTTAGGGAAGTTCCCAAACTATTAGATCTCTCCAAACTTTCTATATTTCTCCAAACGTTCTACATCTCACCAATGTTTCCATATCTCACC
AATCTTTCCATATCTCACCAATGTTTCTATATCTCACCAATCTTTCCATATCTCACCAATCTTTCTATATCTCACCAATCTTTCTATATCTCACCAATCT
TTCTATATCTCACCAATCTTTCCATATCTCACTAATCTTTCCATATCTCACCAATCTTTCCATATCTCACCAATCTTTCCATATCTCACCAATCTTTCTA
TATCTCATCAAACTTTTTAGATCTCACTGAACTTTCTATATATATAAACTTAGATATTTGAACCGTTTTGACAGGTATTCGCATTGCTTTCATCCAGACC
AGCTTGATGTGGTCCACATCAAATAATCATTCTCAAAAATCCGTTCTGTGACCAATGCACACAGACTGCACATCATGATAAAAATCCGCGATATACGGCA
TGATAGCAGGGTAGACACGACTGGAGGGGTAGTTTGCGACTGGAATATTGAGAAACTATGTGAGGCGCCGGGGATAGTGACTGGCATAGTATTGGTGAGG
TTCTGTTTATCTCAAATAAGCCTGTACTTTGTTATGTGATTAATA