Description :
From Genome Similarity Track
Location :
scaffold_208:3619- 10605
Transcript NameFunction/comments
g5673.t1 hypothetical protein PHYSODRAFT_313130
g5674.t1 conserved hypothetical protein
g5675.t1hypothetical protein

Sequence
6986 bases(100 bases per row)
CCGCAGCATCTCCAGCCCCGTCCGAGGACACGGAGGCTTGGCTGAAGACCGGCAGTCAACCACCTGCCAGTGGAGGCCACGATGCTACCACAACCAACGA
CGAGAAGGACGAGGACAACCCTTTCTCGCAGTACTACGGGATGCTGCTGCACCAACAAAACATGCTGCAGGATCACGTACGCACCGGCACCTACCAGCGC
GCAATGCTCTCCAATCCGTCAGATTTTAAGGACAAAGTGGTGCTGGATGTGGGCACGGGATCGGGCATCCTGGCCTTCTTCGCCGTCAAGGCGGGCGCTC
GTAAAGTGTACGCCGTCGAGCTGAGCAACATGGCCGAATGCGCTCGCGAGCTAGTGGCTTCAAACGGCCTCAGTGACCGTATAACCGTCATTAAAGGGAA
GATGGAGGAGGTGCAACTGCCCGAGCAGGTTGACGTGGTGGTATCCGAGCCCATGGGCTTCTTTCTCGTGCACGAGCGCATGCTCGAGACTTTCGTGGCG
GCTGGCAAGAAGTGGCGGCGACAGGCGCCGAGCTTTAAGATGTTCCCGTCCATTGGTACAATGTTTGTGGCACCCTTCTCGGACGACAGTATCTACCGGG
AGCAGATGGCCAAAGTCTCGTTCTGGCAGCAGCAGGACTTCTACGGCGTCAATTTGTCCAGCCTTCGGGCACGGGCAATGGACAACCATTTCTCGCAGCC
TGTGGTTGGCTACTTCCCACCGGAGATCCTGCTGAGCTCACGTCCGGCCGAGCATGTGCTGGATTTTGCTGATGTCACCAAGGAGCAGCTCGACACGTTC
GACTTCCCCTTCCACTTTGTGGTAGAGCGCACTGCCATCATGCACGGACTCGGCTGTTGGTTCACTGTCGACTTTTTGGGCTCCGATGCGCGCGTTGTAC
TTAGCACGGCCCCACACGACGCGGGGACACACTGGTATCAGTGCCGCCTTCTGCTTCCCACTCCCGTTGCGGTCAATGCGTCTCAGAGTGTCAGCGGGAA
CCTTCACTTCGTTGCCAACAAGAAGTTCAGCTACGATATCGATCTCGAAGGTGCGTTACTCCTGTCTATCTGTTGCTTTATGCAAGATGCCTTACATGTT
TATGTTTGCTTTGTGCTGTTGGCAGTTCGTCTGGACGGAACTCCGATCGTGTCTCGGAATCATATTCGGTTGCATGACCAGATGTACCATTACCTGTATT
CACCTGGAGCTGCGGCCACCGCTGATGGAGCTCAACAACAGAGCTCTCCATACTGAAATTGGTGTTACGGGTATGCTCAGAAGCAGGCAGATTTCTGTTA
TGAACTGTTCGCAATGGAAAGAAGGCAGACAAAGCAGCTAAATATCACTCGGACGCATATATAGGGAGGTTGTTAGCCGCGACAGACATCGCATCACGTC
ACTTGCCAAGAGCTGCCTCGACGTCCATAATGTGGTCGATCGCCTTCCTCACGCACGGATCGAAGGCGGCACTTGAGGCGGCAGCAGCCGTCCTCTGCTT
CTTGGGCGAATTGCCGTTCATATGAGCAGAGAACACCTCCATATCGGGTACGACCTCGGTGGCTGGAATGCCCACACTCTCGAAAAGCTCGTTATCTGCA
CTGAAGATACGCTGATGTGGGATTTCAACGGTCCAGTAGTTAGGCAAACGTAGCTGTCGGGTGGGCGACAAGCTGCCGGCGGTAGTAGCGCCGATCCGAC
TCGTAAGTGGGCGCTTCATCAACGACAGACATAGAAGTTCCGCCGTGCTATCTCCACAAACAACACGACAGCCAGTTAGTCTGGTTAAACCCAACCGTTC
AGGCGCACAACCAGGTCAACAGATCATCTTACCCACGAGTGTATTGACTCTGCAGCACGGCCAGAGGACCTCGGTAGCGTGTACAGCGCGACGTGTACGG
GATGTAGTACTTCTTTCTCTTGGAGAACCTAGGCGTAGCTCCTGGCAGCTTCTCGTCCGTTGAAAAGGCCAATGCTGCTTTATTCCCGCTGGCGAAGAAC
GACGCCACCGTCAACGCGGTGACGTGCGAGCCTCCTCCTTGGTTAAAGCGCAGGTCTAGAATCAGTCCGTCCACATCTCCCAGGCCCAGCAAGATCGCTT
CCAGCGACCAGCGCATGGACTCCAGGTCGTAAATCTCAGGCACCGTCACGGAACTGCCAGCCAGACTTCCTCTCCCCTCTCCAGCCTTGCCATCGATATC
CAGCAGCGTCTGACCAGCACCTTCTCCTGAAATTTTACCTGTGGACGCGCCTCTTGTCCATGACGGCACTAGCGCGTCCACTCTGGGCAACGGGAACTCC
ACGAATCCTTGCATGGCCGTAAGACAAATGTATCCGATTCTCCATCCTGGACAGGTCTCAGCATTCAAGATACCGCACACGAAGCGGTCGTTGGCGATCC
TGCGGCCTCCCTGCGTCAGATGTTCCCTCTCAATGGCAGCTAGAGTATGTTGCTGGAACTTCAACGCTGCAGCAGTAGGCAGCTTGTGGCCACGAACAGT
GACCGTCCTGGGTCCTGAAGATCCTGTAGGCCCGGCCACCCTTGAGACCGCGAGCGACGGGTCGTCACAGAGCGACACGCTCTCCTGCAGAGCGATCCAG
AGGTCGTCGTCGCTCGTGGCGGGCTGAATGGCGTCTCCGAACAGCTGGCGCACGAGCTGCCAGTTCACGCGGCGCGGCTCCAGGAGCGCGTAGTGGTCCT
GCATGGCGCGCCAGAAGCTGCGGAACGTCAGCACCGGGTCGCGCGAGTACGTCACGCGCGCGAAGATGGCGCGCAGCAGCTCCAGGAACAGCCGCAATAG
AATCCCATGCAGCGTCATCAGCACGACCAGCGCGCCGCCCAGCACGGGCACGTGGCGTCGCAGGAAACTCACGGGCAGAATGGCCACGGCCTCGTAGAGC
TCCAGAGGCCACAGGATCAGCAGCTGCAGCAGCGCGTCGGGCGTCAACCAATTCAGACGCAGCGGCAGGAGCGCCCAGATCTTCCGAGTCGCAGCCAGCA
TCGTCGCTTGTGCAGATTCCTCCAGGCGAAGGTTGCACTCCAAGTCCTGAAGTGAGGCCGTCGTGTCAGGCGAGCACTTATTCTGGAATGGACAGTTGTT
TTGGGCCACAATGAGATTTTCAGTAGTCGAGTAGCAAATCGTTTTTTTTTGTGAGAACTTTTTTTCACGAATAGATACTTTTTTGCATTTAGCTGACACG
TTATACACTGCGACGTCGCCAATAACAATTAGAGGCTGCTGTAGCGGTGCTGCTCGTGCGGGAGGACGTTGGCCAGTTGCTCCTCGATGTAATCGCGTAC
TAGCGGTGAGAACACGTCGAGCTGCATCTGTCCGTTGAACATGGCGTCGTGGCCGAACTTGGAGTCCACCTCCACGAGCTGCGCGTTGTGGCCGTACGAC
TGCAGGATGTTCACCAGGTTGCGCTGTTCCTGGATTGGAATCAGTAGATCCTGCTTGATGCCGATGACAAGGCTGTCGCACGAGATGCGGCTCGTGCCCT
CGGCCAGGTTCAGCGAGTTGCGACCCAGGTTTGTCAGGTCCATAGCCTTGGACAGCAGCAGGTAGCAGTTCGGGTCAAAGAGACGAGCAAACTTGTTCGC
TTGGTAGTCCATGTAACTCTCAACTTCGAACGTGGCCGTCTTGAAATGCATGGGACCCGTCGGGTTCCAGTCGAAACGCGCGTCGAACTCCTCGCGCGAG
CGGTAACACGTCATTCCCAGCTCACGCGCCACCTTCATGCCCTCAAGCGGCGCACCGGGCGTGTAGTTGCCATCCTTGTACTCCGGGTCGGCGAGGATCG
CACGGCGCTGCACACGTCGAAAGGCGACCGTGCCGGGGGTGGTCTGGTGCGTGCAGGCGAGTCCAACAAGGCGGTCCAGACGGTCCGGGAACTGGGCCGC
GAATTCAAGTGCCTGGATGCCGCCCATGCTGGCACCGATGACAGTGTGAACGCTGTCAATACCCAGGTCGTCCAAGATCTTGGCATGGCAACGAGCCATA
TCAGCGGGCGTGAGCTGCGGGAACGAGGCCTTGTACTTCTCGCCCGTGAGCGGGTTGACCGTCAACGGCGACGTGGCTCCGAACGGACTGCCCAGGACGG
ACGGACAGATGACGCGGAAGTAGGACGTGTTGATGGCCTTGCCAGGACCGATCATGTTCTCCCACCAGCCAGGACGGGGGTCATCTCGGTTAGAGGCAGC
GTGGCTTGAATGCGAGAACGACGGCAGCACCAGGATAGTGCGGTCCCCAGGTAGGGAGCAGTCGCCCCACTGCTCCCAGTCGATGGTCACCTCAGGCAGT
GAGCCGCCCAGCTCCAACGGGAACTCGTCCTTGAGCACGGACTGGTACTTATTGCGCGTGAGCGTGAAGTCGCCACCGCCGTTGTGCTTGGGGTCCACCA
CGTACGAGCGCTGCTGTTGCGCGTAGTTCAAGACACTGCGGCGTGCGAGTTGCGAGGCTGCGGGGCTCTGGCGAAGAGCTGCCTGTGCGATGCGACTGCA
AGGAGTGAAAACTGTTAGTTGCTGAGCAAGAGATCGGTTTGTAGGCAGAAGGAATAGCCTACCGAGCCAGCATTTGCGGTGTGCTTCCTCTCACTCTGAG
CTCTGCAAGGTAGAAGATTGAATGAGCTGGAAGGAAGTTTTGCTTGGACCGTGACGAGGCGCGAAATCGACACTCCATTGGCTGATAGTTACCTCGCTTT
ACGAACTTCGAGTGAAAATTGCCCCGTAGCCGTTGACCGCCTTTCTCTGCGCGGATATTGTCACTGACAAATTGTCAGGCACGGCCTGTCAGGCAGCCTA
GCACTGCTCCAGCACTGCTGGACGGTCTGGCACTGCCAGTCGTTGATGGATAACCAACACAAGTTGTAATTCACCACTGTGGACCACAGAGCCACATCAA
ATTTCCATTGTCGGATAGCGAGCAACACTGCAGTGGTTCTGTGACCACAGTTTATTAAACGCACTAGCAGTCTCACAAAAGGCCCGCAGTTTTTTCTATA
GCTCGAGGTTTTCCAGCGCGGTAGTCAAGAAGTCGAGTTAGAAAACCAGGACTCCTGGAGCTATATGGCAGAAAAACTCGTCGAACGCCAACCAAAACAT
GGCTTGCAAATTAACCAAAGAAAAATGTGATAAGCAAATTGCTGTTGTCAGTAGACACGACCGTTGCGGTGTGCCATTCACTGGGCAACCTTGTACACGC
CAATTGGGCCTATCAATGGCAGTGCAGCTTCGTCCCGGTTGTAGTGAAACGATGTACTTAATCAGTAAGTCGCGCTGCAAGGAATCCTGGCCAAGGATAA
GGTAAAGTAGGGATCAAAAATGAGTAAACCCCCTTCTATTGTCAATATTAGAGACTTACCGGTAGAACCGTATTTTGTCAAAAAGTACTTCGTCATCGTG
AGTCATCCTAAATTCGTCTACAAAATTTCATATACAGAATAATTTTTGATGGTCGTGTCAATCAAAAATGCATTCCGTTTACATGTATTTTGTTCGGTAC
GAACTAACATCAATCTTTATGTCTATGCATAACCAGCAAACGCTAGCGCATTTACAGGTAAGTCGTGTCGACCCACCACTCCGTTTCGTAGCCCTCGCCG
AGGACCTCGTTGATAGCCACAGGAGCGTCCAGCTGTCCACTGAAGGCAACGCGGTTGGCGGTGGCGGCGCCAGGGCCCGTGTTGCCGAATTCCTTAAAGA
TAACCTTGTCCGTGCTGGAAGTGGCGTCCCATTTCGCCCATCCCTCCGGCTTGACCACATCGCCGAGCTCGCTATTCTGCCAAATGACCTTGGCAAACGG
ACGCCACGGGCGGCCCAGCACCGTCGAGTTCACGCCGCTCTTACCGAACACACGGGCCTTGTTGAAGACGTACGTGGCCGAGCTGGACTCGGATTCACGG
CCGCTGGCAGTGATGAAACCAGTGCCAATGGTCTCGATGTCGCACTTCTCGAACCAGGCCTGCGCGTAGCGACCGAAGACGAAGTCGGTGGCGCCGTTGA
TGTACGTGCGCGCGTAGAGCTCGCGGCCCTTGTCAGCGAGCACAGTGTCCTGGTAGCCTGTGAGGTTGCAAGCGTAGAAGCCGTAGTCGGTGGCGTTGAC
GTTGACAGCCAGCGCCTGGCCGACGTTACCGGCCGTGTTGGCGATGTTGAGGTTGTACACCTTGACGTTGTCGGAGTAGAAGCGCACCGTACTGGTCATG
TCATTACGGGACTCACCCGTCACCGTGGCAGGGATGTCCTTCTGGGCCTTGCCCTGGGTGATGGTCGCCTCGTTGCTGGAGTAAGACGTAGCGTCACACG
TGAAGCCCTGCAGCACCAGGGGGCCCGACAGAGGAGCGACGTAAACTTGCTCGTTGTAGACGCCAGGACGCACGAAGACGGTCTGCTCCGACGTCGTGTT
GGGGTCCAGTCTCGCCACACCCTCCGACACCGTCTTGAAACTGTTCTTGTACGCGCCCGTGGCGTCAACGACAATAGCGCCAGCCGGCGGCTCCGTGCGC
GCGTTCGGTCCGGTGCAAGTCTGTTGCGCAAGAGCTCCAGCCACCAGGCCGGTGAGTGCAACAAGCGGGGTGAAAATCTGCATCGTAGAGGTGTTCGTGC
GACGAGGAAGTTTTAAGAATGAGCTGCGAGAAGGAGAGATTAAAAAGGTTGTTGATCCAGAGTGCCGGATGCCACCCGGTCCGCTGTTCGTGTGCTTGTG
TAGCTTTGCAACTCGCAAATGTTTTCCCCTTCCCCGCCCAAGTGGCATCACGGACGTCAAGCTTATGGCTCTGACAGAGCCTCCGATGATGGTCGTATTT
CGAAGTTCGTTAGTAGTCCATGTACGGTACAAGAAAAGTTATTTGGTCTGCAAATTGCAGTGCCATGGTATCCAAGATAATGGCCGTTCAAGTATCGATC
GCCCAACAGCCGAAATTCACGTGACTTTACACGAAGCCACGTGAGTCAACGTGCAAGTTACCGTAAGTAAGGTGCACCTGTGAGTT