Description :
From Genome Similarity Track
Location :
Scaffold_1:36185- 37812
Sequence
1627 bases(100 bases per row)
CCAGCTGACTTGTGGCTCGTACCTTCTAATCCATGGTAAACCAAGGATAAAATCAAGTTTTTCATCCAAGTCCAAGACGGTGAAGTCATCATCGTATTGG
AATTCTTTCAGTGTATAGGAAATCCTCACTACACGTTTCATCACTGTTACGGATGCGAATGTCGCGAGGAGTACCGTCACCCTCGGTGGAGGGATCTCGC
GCTCGATATAGTTGAGCTCGCTGTTGTCCAGCGATTGGCGTCGTACAAAGTTGTTCGACGTCCCACAATCGACTAGGGCTTGAAGCGGCATATTTCGTGT
CACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATGATTGAGTGTTGGGAGAAACTTTCGTCTAGAGGCCTGCAAAA
TCCCTCGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTCTTGGCTGTCCGTTTCGTTGTTGCGTCTTCGCAACAACTACGGA
CCCACGCCTTGTACCTCTCTTGGCCGTTTGGTGGTTATTGTTTCCTGCGGTACGTGGTACCGCTCTCGGGGCACTGCATTCGTATGCATAATGCCCTGTC
TTCTGACATCTATTGCATTTTTGCAATTTCTTGTAATTGTTAACACGAGAGCTCTCGCTCCCCGCGTGACAGAGGTCCATTGGTTCTGGGCCTTCATTTT
CCTGTGTTCTCGATGGACGATAAGAATTCAAATTCGCGTGAGCCTGTATCACGCTGAAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCTAGGGTGTT
GAATTCCAACCGGAACTGGTAGGTTTTAACAGGACCATCTGTCAGACCCTGCATGAACAACGTAATCAACTTTTGTTGATTCAGTGGGTCGACTGTTATG
CAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTATCTTGCTTAATTCTCAGTAGTTCAGAGCGAGCCCTGAACTCAGCTCGCG
GCGGCTCAATAGTTTATCTAAGCAGAGACTTGAAGACTTCCAACGACCCAAAGACATAGGTCGTGTAACTGAAGGCCCAAGGCCCAAGTGTTCGCACGCT
CTGCCAGTTTGATTGAGCAAATGTGACCTGCATTTGCTCATCGATGATGTGACGAGCCCTTATAGCGTCATCTAGATCAACAAACCATCTCAGCAGGGAA
TCTTCTTCAGCTGCGTTGTATTTGGAGACGTCAATTTTCAGTGATTCGGGTCGACATGAGTGTGTCGACCCGGTAGCAGTAGCCTGCTGCTGTCTCAACA
ACTCGAACTGTTGAGCACTCTGTCCTCTCAACAGCTCTGTCTGTTGAGACCCTTGTTGGTCAAGCAAGGCTACCTTTCCCCGTTCAGCCTCAAGTTCATT
TTGAATGAACTTGGCGATGGTGGTGTGTCACCCGTCTGGACCCAGAGCGGATAGCATTGCGCCTACGACTTCTTGCTTTATTGTGGAACTCAAACGTTCG
ACGGCATTCCATTCGATTTGACTCAAATGGGAGTAGCTCTCGTTCGCTGGGTGGAAGTCTTCCGCTTCATCATCTAACATGTTCGTAGTTGTTGGACGAA
CTACAAAGTGCTACCAGGTGTAACGGG