Description :
From Genome Similarity Track
Location :
Scaffold_45:3618- 9912
Transcript NameFunction/comments
g3234.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae
g3235.t1hypothetical protein
g3236.t1hypothetical protein
g3237.t1POM68330.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
6294 bases(100 bases per row)
TTCGAGTGCTGTAGGCGACTTCAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGT
CCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATG
ACCAACAATTCGTTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCACAACGGGGGTGGGGGCGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGA
GTCTCGCCTGAAGGCTGTTGAGCGCCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTGAAGGCTCAGCTCGCGGAGGTTGCGCAG
ACGACCTCGAACGTAAAGGTCGAGGTCGAGGCGAGGCTCTCTGGCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCGCTTGGCGAGTCACCAGACGTAGGT
GACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAATGTTTAGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCG
CCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAAT
GAACCCACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCGGCTTCTGTCGATTGACAGAAGCTGCTATTGCATCTTGGACAAACCGAA
TTACGGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCTTGCGTGTGATG
TTCGTTATCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTG
CTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATACCCTCCCCCACTTAAGGAAGGAGCTACCGCACTGAGTGCGCTCGGTACGCGTGGGT
GCCTCAAGGCATTCACGTAGAACGGTGTGTGTTCAGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGGTCCATTGATG
GAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAAC
TGCGTCCCAAGAAGTGTTTACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATGTCGACAAACAGACATG
CCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTTGTTGTC
TTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGAGCTGGC
ATACCTCGCAAGCACGAACGTACTTGTGTACCCATTTGTACTGGTGGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGAT
GTCCCGATGTCGGGGCATCGTGGTACTCATACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCT
GTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTAC
TCCACCAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTT
GGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCA
GCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTAC
TCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACG
CGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGG
CGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCT
CTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTT
TACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCG
GTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCG
ATCTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAA
CGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGAATATCACTCTCACGC
ATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTTT
GCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCACTGTGCGGGGA
CTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAG
TACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCA
AGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGAT
GAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGC
TTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGCCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCA
AGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTC
TCGCTTGTGCCGTTCACTTCTCGTGCGCAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGT
TCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCAGGAC
GTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTACCTCTACGCCTAACGACGGAGTGTCTTTCGACCAATTGTGTG
TCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGTTTCACATCTTCTTC
CAACGACTCTCGCAGTCGTTGGCGTTCGCTTTGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATG
TGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCATCCAGTCGATCACCGGATCATGCCGTGCA
AGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTCGGTAAGAGAAGCGTACGCGTA
CGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCATCTCCTCGAAGTCAAGCCTTGGAAGGCT
CTGCAGTCGAACAAAGTTGTTCGATGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTG
TCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCGTTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGC
GCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCGGTATCGCCACGACGGCTCCTCGTCGCGTGCACAGGTGCTGTGCACTCG
CGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTG
GTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGC
AAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTC
GCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGATTGCCCTGTTGCAGATCGAGGAACT
CCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCG
GCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGACGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTG
TCGACCTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTTAACGACTCCACGCGCGGTGTGGCCGATGGCG
ACACCGAAGTTCGAGCAGCGGTTTCACGTTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGC
TACCGCCGCTTCCCTAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGAC
GTGTTTGAGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTA
CAAAGTGCTACCAGGTGTGGTGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTT
CAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTC
CTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTC
TACCAGTCATATGCCTTTTGCTATGTATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG