Description :
From Genome Similarity Track
Location :
Scaffold_408:3618- 4677
Transcript NameFunction/comments
g17583.t1hypothetical protein

Sequence
1059 bases(100 bases per row)
CCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGA
CCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCC
TTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCACTGATGAACACGATGC
GCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCA
CAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTG
AGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTT
CGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCTGTTGCGACTTCCGAATTGTTGATGTCGGCGTACAT
CTCGTCGATCATGCGCCGCATACCTCGCGGAGTAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGT
GGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCAC
TATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGGCGCACCGTATGGAAAAGTGGCCACAGTTTGGATGACTTCAGGCATGCGTCGATTGT
CTCTGTCGCCGAGCCGCCCTTCGCCACCTGGAGAATTTGCCTCCCTGAAACTCGACCAC