Description :
From Genome Similarity Track
Location :
Scaffold_513:3616- 5857
Transcript NameFunction/comments
Phypl_g9049hypothetical protein PHYSODRAFT_554223

Sequence
2241 bases(100 bases per row)
GTAGCGGCGGTGACCAGGAAGAAcgtcagcacgagcacggcgatcTTCATGATCGACACGAaacttgtcgtcgtctgcacGAACTTCGAGTGGTGCGGCG
ACTGAATTTCCAGGTAGAAGAAAAACAGCACGTTCAGTGCAAGAATAATAGATACCTGCACCGTGCCGGACATGCTGGCACAACCCGTGATCACACCCGT
CGTCAGCGCAAGCATCATCTTGGCAGCAAAGAAGTAGCGATTCTTGAACTTGTACTCCTCATACAGAGGGCCGTAACGCATATTCACGGTCTTCTTCAGG
TGCTGCACCGTACCAACATCCGTGATCTCAGcctcgtgcttcttgatAACAACGTAGCCATACACGAGAATGCCCGCAGCCAGGAAAATAATAGCAGCGA
TAGCCAGCAGGCACTTCGGGTCCGAGATACTCTCGTTCTTCGTCGAATAGTAGATCTGGAACGTGGCCGTCACACCGATAGTATACTGCGACAAGATGGC
CACGAGCACCTCAAGACCAATCATCTTGTCGAAGAACTTGCTCAGGTACTCCTCACGAGGCATCATAAGGCCGGAGATCAGGTAACCCACACCGAACAAA
CCAACGACACAGGCCATCACGCAGAACACACCAGCCAGCGTCACAACGAACAGCATGTCTTCCTGGATGTTCAGCTGGCGAGCGTACTTGGCGATACCAG
TGAGCTGATctgagctgctcgagctgccgctgccgctggtgcttGAACTCGCCAGACGACGGccggaggtgctgctgctgcttgacgtACTACTgctgcc
cgagctgctgctgtccgatTCAGAATCGCTCAGCTTTCCGAACGGGAGGAACGTGAACGCCGCGGGGGCCATAGCCTTACCGAACTGCGCTAGTGCCGAC
GACTTGCcatcaagctgaagctggttGACGAGCACGCCGAACTGGCAAATCTCAACCGTCGTGATAGCCATGGTAgagccagcggcagcgagcgaAGCAC
CCGCAGAACTGACTCCGCCTACAGCAGTACTGGCAATAGCGGCGATACCGGTAATCGCGACAGTCACACCAGCAACGCTCTTCGACGTAGCAGCCACCAC
CGTACCGGTCGTGGTGGTGTTGTCCTTGGTAATGACACCGTCAGCCTCgtcctgcacgcgctggtgcttctTGGCAGCATCCGCCACACTTCCCGAGCTG
TTGCTGTCTACCAGCATAGCCGAGCACGTGCACGAGGAGAACGAGTCCTCCGACGAGTACGTGCACTGCTTCGATCCCGACATGGTCGAATTCGACAGGA
ACGTCGACACCGTGGACGagcgctcctccagcgccgcgaccACCTCGCTCGTGAGGAACGACTCGATGCTCAAACCGTCGTACACAGACGACGAGATACC
GTTGCTTGAGCCGTACACCCATGCGCTGTTCGTGCACGCCGGGAACGAGCAGATAGAAACGCACGTGGAGCCCGAGGTGCTGCCCACCGTGCCACTGTAA
ATCACACAGCTGGAGGCCGACACGGCCGAGTCCACGTTAATGCCAGATCCGCCGCACGTCAGGCCTAGCGTGTCCCACTTGGAGTAGAACGTGCTGTCGC
AGCTCAGAACGTCCGAgcccgaggagctcgagcccACCGAGCCAGTCATCGAGCTAGATCCTGCATtagtcgtagtcgtcgaggtcgaggtcgagcCGGT
CGTTCCAGTCGTTCCAGTCGTTCCAGCAGTCGACGTTGTGCCGGTCGTTCCTGTCGTTCCTGCCGTTCCTGTGGTCGAACCTGACGTTCCAGCAGTCGTA
GAGGTGGTCGTGGCCTGCAGCTTACGAACGCCAACCGACACCAACGTGGTGGTTCCTGCCGCAGTGCCCGACGATcccgaggacgtggtggtcgGCGAAG
TGGTCGCCGTAGAGGGtgccgtcgtggccgagcccgtcgtcgtcgtagtgGATGCACTTCCGGCGGTGGTACTAGTGGCTGTCGTGGCGGACGGCGTGGC
TGTAGTCGAAGACGGGGttttggtggtggacgagggcatagtcgtcgtcgtcgtcgagacGCCAGCGCTGCCCGTGGAGTCGGCGCTGCCTGTCGTGGTG
CCAGTGGAGGTTCCGCCGCTGGATCCGgccgccgtggacgtggaggagctcgaggagctgctgcccacgtCCGCGTTGCGCTTGCCCTGGCTGCCAGCGT
CCGAGAAGTCGCCGCCCGAGccggaggagctcgaggacgag