Description :
From Genome Similarity Track
Location :
contig_37:361586- 362997
Transcript NameFunction/comments
g8955.t1hypothetical protein
g8956.t1KUF79835.1 Negative elongation factor D [Phytophthora nicotianae

Sequence
1411 bases(100 bases per row)
CAACATTCTGTAGTAAAGGCTATTTAGTCATTGTAAACAGCGCACACGTGCGTGTTTGCACAAATGTATTGATTTCATTTATTGCTGAAGCAGCTCCTGC
TTCCACATAGCGAGCATCTTGCGCAGCTCCGGCTCCCAGTCACTCACCACCTTCTTTGCGGCGAGTTCGCGCTGGCTGCTACCGTTGGTTGAGACGAGCA
CCTCATAGTCGTCGCCGCTCGTGTCGTCAAAGTCCTGCAGCTCCACATGGCCCGATACATCGTCACTGCCCTCCCACGCGAACTTGACCGACAGTTCGTA
GCCGCAGCGCTTTTTGCCGCGACTAAAGACGATCTTCTCAAAGCACGAAATCTCAGCCACAAACCCCTCTTCAAAACACTTTTACCCACTCACCTTCGCT
TCACCGTCACAACGCACAATGGACGTGGCCTTGATGGACAGTCCCTGCGCCTCGTCTTCGAAGCTGAAGGCCGTGAGGATGTGGTGTTTCAGTCGCTCAC
GAGCCCACTCGGACTTGTCGCGCTCCTCCCTGCAGACACCAGTTAGAAAAACTCCTTCCCCGCCGACACCAACCAGTAACTCCGCAGCGCACCAAGTGCC
TGCCGCATTCCACACGGAGCTGGAGTCGCTCCGATGCACGGGAGCCGTCACCGCCGCCGAATGGTCGATCCGCACAGGGGTGAAGTCCTGAATCCGCGGA
ATTCCAGCACCAAAAACAGCATTTTAGTCCCCATTTCAGCAGTAAATTAATGCTACTACACCCGCACCTGCGACGTCTTGGGGATCGTCTTCATCCAGCC
GTGGTACCCGCTGTGCATCTTGGGGGCGTCTTCCTCACCGCTCGACATCGTATCTGCTGGAATATTCGATAATGACGCCGCATTCACGTCTTTTCATCCA
ATCACCTACCTCCACTCTCCTCATTCGTTAAAAATCAAATCATCATCTACCCATACATTAAAAAAGGTAGAGCGCCCTACCATGCCGGGTGTCTGGAGCG
CGCACGTGACCAAGGAGGGCCGCACATACTTCTACAACCGCACCACGAAGCAAAGCGCGTGGGAGAAGCCCGAGGACTTTGACGGAGACGAACCCCCTGC
CCCCTTTGGCGCCAAGAGGCTCGAGTGGGAGGAGCTCTGGGACCCCAAGAACGAACGCGCCTATTACTACAACCGGGCGACGCGCAAGACCCAATGGCAG
AAACCCGAGGGCGTGGAGATCAAGCCCCGCGCGGGAGCGAGCGACAAGAAACACGACAAGCACCGAACCAAGGCCAGGAAGGGCGACGAGAACGGTTCTA
CCCCGCGGGAGAACGAGCCTACCGAGGCTGAGGAGAGCAAGGCTAAAAGTAGTCGGGAGGAGAATCAGACGCAGAATCAGGCTGAAGATCCGAATCAGAC
TCGGAACGACG