Description :
From Genome Similarity Track
Location :
Scaffold_9:361552- 362711
Transcript NameFunction/comments
g5571.t1hypothetical protein

Sequence
1159 bases(100 bases per row)
TCATGCAAAACTTTGTCCCCATCTCTTTGAACGTCTCGCTGGAGTTCGTCAAGTATTGGCAAGCCTACTTTATAGAGCAGGACCTGGAGATGTACGACAA
GCAATCCGATACTCCTGCAATGGTGCGATCATCAGCTCTCAACGAAGATTTAGGCCGCGTGCATCATGTCTTTACGGACAAAACCGGCACGCTCACGATG
AATCTTATGCTCTTTCGTTACTGTATGGTTGGAGGACGACATTACGGTGGTCTGATGCAAGACAACGATATGGTAGCGGAGGAGGCCAACGAGCCTTCAT
CTCCCTCGATGGCTGCCATAAATGATGGCCCACGATTTGTTGACTTCGACCCAAGCGAGCTGTTTGCCGACATTCAGGCAGGAGGAGAGCAGGCGCAAAC
TCTTCGTCGATTTTTACGGCACTTGGCAGTTTGCCATACGTTGATCCCGACCAAATCGTTTGCTGAAATGTGCAGTACGTCTTTCCCAGAGTACTCTGCG
TCATCGCCCGATGAACAGGCACTAGTTTCTGCAGCGGCCTTCTGTAATGTGCGCTTTGTGCACAGAACACCCACTACCATGATGGTCATGGAGCCAGGTT
GGGCAACTCCTAACACATACAAACTGCTAAATGTGCTGGAATTTGACAGCGACCGAAAGCGCATGACGGTAATTGTAGAGGCCCCCGATGGTGCGATTGA
ACTCCTTTGCAAAGGCGCGGACAATGTCATTTTTGAGCGTCTTGCAGCGGATCAAGCGACTTTGCCTGGTGGTATGTCTAGCGAACAAGCAGCTGAACAA
CTCACGCTGTACGCGAAGGCTGGTATGCGCACGCTCTGCCTCGCTTATAAAACGATCGGCAGATCTGAGTACGAGACATGGAGTGCCCGTTATACGCAGG
CGCATGGTTCGATGGAGGAATTAGTAAAACGACGTCAAGGCCGTGCAAATGCGATTGACCCGCTGATGAACGAGATTGAACGTGATCTTATCCTACTTGG
GGTCACTGCGGTCCAAGATAAACTCCAAGCTGGGGTGCCTGCAACACTTCGGCTCCTGCAAGAGACCAACATAAAGGTTTGGACACTCACAGGTGACAAA
ATGGAGACTGCTGTGAATATTGGGTATGCCAGCGCGCTGCTTTCTCACGATATGAATCT