Description :
From Genome Similarity Track
Location :
Scaffold_354:36155- 37180
Sequence
1025 bases(100 bases per row)
GGACACTCTCGGACTTCGAGTGCCAACTTTCCTAGCGAATTTCTCAATTTTCGCGGTCGGGATGGCCCTTTCTTCAGagtcatcttcgtcttcgacagTC
CTCAGGAGTCGCTGGCTTGTTGTAGCGGACGAAGCAATTTTCGAGACCGTCGCTTGTTCAGCGTTCACGGTTGCCGAGAGAGCCTCGCTGGCAATCAGGA
AGGAGGCCACGATCAGAACCACAACGGAAGAAAGACGCATGGGTACGTTCTGTTGAAATCGGGAACTTGAGCGCTGGAAAGAAAATGCCGAAGTGAGGAC
CCAACAGAAAAGGATTCCAAGAGAAGATTTTAAGTCCGAGTCACGGCGTGACGGTTACTTTTGGTGTGGTGAAAGTAATTTTTCACGGGATGGGAGAAGG
GTTCGGACTTGACGGCTTCTCTGAAGTCATCGCGAGAATCGAATGGCTCGCAAATCACGTGCCAGAAATCGCAGAAGTCCCAGTCAACTCCTCATTCTGT
AATGTGCTTTCGACTAACTAGCCTAGGAGACCCTACCATAAACTTTAAACCCCTCCACGCCACGCCCCAGCAGGACGCAATGTCAATACAACAAGCTTCG
CACCCGAACACCAAGTGAAATCAGATATTACTCGGCGATGGGGGGCGTTGTCGCAGTTCGTAAAAGTCTAGTTTACTAATAAGTCCAGTGTATTAGCCGT
TTAATTTCAAAGCCGTGCCTTCGCCCACACGTCGTAGCAACGACTTGGCTCGAAACCTCATGGGGGGGGGCTGTGTCTCCAATCGGGGGAAGAATGGAGT
ATGACCGGGTTTCTTGACGAATTGGTGGCACTAAGCACCCACTCGTGGCTGTGCCTGGACCAGCTCTCACTTCGCCAATGCGATtccacgacggaggagc
tgaacaCGACGATCCCGGACGTCTTCAAGAACTCCCTTGTGCTCCTTCTACTCCCGGGACGCCGTGTCATGAGTGGTCGATACAATCCACAGATGGTGCA
AGTGTGGTCATCGAGCAATTGATGA