Description :
From Genome Similarity Track
Location :
contig_8:36148- 38949
Transcript NameFunction/comments
g1794.t1hypothetical protein

Sequence
2801 bases(100 bases per row)
CCAGGCTTGTTCTCTCTGGAAGAGCAGGTTCACCTCGCAACACGCGTCTGTGATGAGCGCTTACTGGAGTTGAAAACGAAGCACGCAGCTCAAGCCGCCC
AAATTCGCTCAGAAGCAGAGTCTACGAGAGACCAGGCGCTGGCCATCCTGCATCAAAAGCAGCGCGACGCACCAGCTACTCCATTGCTGGAAGCCTTCCA
GCTTGTGGAAACGCGCTACCAACGCGAACTGCGCTCGAAACTCGCTCGCGTTGATCTTCGATGGCAGCAGGATAGTGACGACCTCCGACGTGAACGCGAA
GTCGAGAGCGAGAGCGTAGCAGCTACGGTCATGGCGCTCACGAGACCTCTCGGCGTCACTAGCGGGAAGTGGGCAAGCGCAGTGGCTCGCATGTGCTCGA
AACTGCGCGTTGTCCTGCTAATTGACAAGAAGCACGAAAGGCGCGTGCGCTCTTCGAGCTCAAATGTCTTCGCAACGTGCGATGTCGTGTCAGTGCCGCA
GCTCGGTCGCGATTCTCTTCGTACGCTGGTGTTTGGTCATTTCCACGCTCAGGTCCAGCAGCTACTGGGCGGAAACAGCCCAGCAGAAACAGGTTTGGTC
GACTTCTTACATCAAACGCTGCGGAGTCTCTGGACTCTGGCGTGCATGGCTACCGACATGCACCTCGCTGTGGTCGACGCGTTCTCAGCAGAAGCAACTG
CCGATGAACAGAGCCGCCCTCCTCTTGTGAGAGCGTTTGCCATGGCCTCGATCTTCGCCAAACTCGTAGTGGACGGCTACAAGCGTGAAGAAGAAGCTCG
AGCCAAAGCTTCGTGGTTTCTTGATCTTTCTAACCGCTTGGATCGAGACTTGGGCGCTTTGCGGTCGAGTGATGCCGTCCTCAGTGAGCAGCTCACGACG
ATCGCCCAACAGCTCACCACGCACGCAGCAAAGCTGGTCGAGCAAAAGGAAGACGCGGAACGAATACGCACTATCATGCAGCGCTTCCAGGTAGCGGCCG
ATGAGCAGATTCTAGTCACCAACGAAGCTCAAGAAGTGGCGCAGCGCGAATTACAGGAACCCATGGCATGTCTGGAGGAAGCCAACCGTGCGCTGCTGCT
CGTGGACAGGCGACATATCGTGGAGATCAAGTCGTTTGTCAGCCCGCCGCCACTAGTTCACTTGGTGCTGGGCGCAGTGTGTGTGCTGTTCCAGCTTGAG
CCGTCTTGGGAGAGCGCTCGACGCTTGCTGCTGGGAGATGCCAACGTAGTGCAGACTCTGCTTCAGTTCAACAAAGACGCAGTGTCCGCTGCAACGCTGG
CAAAGCTGGAAGCCGAGTTTCTTCGCGACGAGCGGTTCTGTCGTGAAGAAGTCGAGCGACAGAGCGTAGCTGCTGCCTCCATGGTCGGCTGGGTGCGTGC
AATTTATCAGTACGCGTCGGCGCGACACCAAGTGCAGCCCACGCTCGATAAGCTCGAGAAGGCCCAGAGTCGCCTGAACCTCATCATGCAGGAGTTCCAG
GTAAGCAAGCAGCGCGTCGTCGAGGCGGACGAAGCCTGGCAAGTGACTCAAGCTGCCATCGATGCTGCAACAACTCGGAAAGAGGCCTTGACGGGTGAGA
TCGCTTCGCTCGGTGCTCGGTGTGATAGTGGGGGGCTTGCAATGCAGGCACTGCAGGAAGACCGACAGCGTCAACAGGGAGCAGCAAGTGCCAGCTCCAT
GCGACGAGGTTTCTCGCTCACGTCCTGGAACGCTCTCCTTTCAGCTGGAGCGTTGGCGTACGCGTGTGAGCTCAGTCTTTCTCCACGTCGAGACCAAGTT
TTCCAAGCGTGGGAATCTGCCTACTGCAGCTACGGAGGGTTGGCACCTGGCTGTCCACCGACTTCAACGTGCTGTACATTTGTGCCTTCCATTGCTGTGG
TCCTGAAGGATTCGGCGCTGTCTGGTGAACAGACGAGAGACGTACAGGTTAACCGTGAGCGCGAGACGCCGTTGACTGCCTTGTTCACTGGAGACTATCC
TGAAGATGGCAATCCAGAAGCAGAGAACACCATGAAGTTAGTCACCGCGATGGCGGGTGTGTGCTTCTCGCGACGCAGCCTTTGGGACGCTTTTCTGCTG
TCTCTACTAGCAGCAACACCGACCTTACCTGTGGTGATGATCACTCGCTACTCTCCAGAACTCGAAGAATTGCTGGTGACTTGTGCTCGTCGTGTATGGC
ACTGGAACCAGCTGCGCATGGTACACGCTCGATCTCCTGACTTTGACGACGAGTTCCGCTTGGCTGCACGCTTGGGTCACCAACTGCTGGTGCTCGACGT
CGAGCCCCTGGATTCAGAGCCGCAATCCGATTCGGAGCACGGTATCTGCTTGCATTCAGCGCTTGCCTGGACAACTGCCCGCGTCAATGGCGCTGAGAAC
CTGTTAGTGCCTCGCAGAACTCGAGAAGTTGATGGAGATGACACTCCGAACGCTGGGTCCGCCACAGATTTCATTCCACTGCACTCGAACTTCCGTTTGA
TCCTGACGTCTCACGCATCGCGGACATCGTTTGGCGAAGCGTTGGATATGATCCCACGCTGGATGCACAGCTACACTCGAGCGACGTGGGGGACGTGATG
CTTGACAAGATGTGGAGCAGCTCAGCTCTGAAAACGTCTGAGAGTGCAGACTCCGTCGCAAACACAGGAGGGGCCAAGTTGAAAAGGGCGCTGCGTGAAC
ATGGCCAACTTGCACAGCAGTTCGAGGCATCACACGCTCAACTGACAAAGCTACTGGAGGCTGCAGCAGTAACCAGCCAGTTCCCACTTACGCAGACTCA
A