Description :
From Genome Similarity Track
Location :
Scaffold_509:3614- 9413
Transcript NameFunction/comments
Physo_125946reverse transcriptase
Physo_125950reverse transcriptase

Sequence
5799 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTATGGTACACCAATGGCTACATACATTTTCGACCACCACGACGGGTGGTCCATACACATTTAGGATTCCTATTGGCTGAAA
GCAGCATCTTTTAGCCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTC
AGAAACATAAAACAAAATTGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACACGGAGGCCCGAGTATAATTAA
CTCTAATTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGAACTTTGT
AGTCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCTCC
ACTTCGCCTGCAACTCATGTTGCACGCGCTAACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTTCAACGACTGTCAACAGTCATTGGAGAAGCGG
CTGTAGCTGTAATGCTGCGCACACTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTATCAC
GGTGGCGTCGGGGACGACACCGCGCGAGCAAACGTTGAAGCTAAATGTGAGCAACTATGTCAGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAA
CTCGACACTGCCATCGCGGCTCAACGTATCGTCGACCCGTTGTCCGAGGTTACGTTCGCCGTGGCATGGCTTGGCGGACGAGCGAGAAGTTGGGCGTATG
GACGCCGACTCTGATCCTATGTGCTTCAGCACGTATGAGGGTTCAAGGAGGAACTCAGACAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGGTCGAGGGC
ACAGTTCCTCGAGCTACAGCAGGGTAAGCATGATGTCCATGCTTACGCGCAGAGAGCACAGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAG
GCGACCAAGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTC
TTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGAAGGGAGGCCCAGAACT
CGTGGACCTCTCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGATGCGGTAGAGTCGGTCACTTTGCTCGGGAG
TGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGAGCC
CTACTGGAAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGTTTCATTCTCACTGCAAGAACCAAGATGACAA
GCCTGACCTTGTCATCCTGAATGGGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGTGCGTCGAAGAACTTTGTTCGACTGCGA
AGTCTATCAAGGCTTGACTTCGAGTATTTAAAGATACATCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGG
TACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCCTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCT
TGCACAGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGACGGCCCTGGGCGCGCGCGAGCA
CACGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAG
AGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTAGATCAGGTCTGGCCAATAATAA
GAGCCAAGGTGGCGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCTGCAGGCGGTGCGGACGGT
TGCAAACGTCCCGCACCGGAAAAACTTGCATGCTATCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGC
GGGATGAACCCGCCGGCGGTACTAAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAG
ACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAG
ACGCTGAACGTCTTGACGCATACCTGTGCCGGGTTTCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAG
GCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGA
ACTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTATGCACTC
GCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTACCCAGACCACACGTCGCTGCGGACAGCTGTGAAGTCGCCGCACATCTCGCAAC
GGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCAACC
TGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATACGATCGAGCACCCCAACGTCGTCACTGTTGGGCGACGTGAAGGTCGCGTACGCG
CACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTT
ACCGGGTGCACGACGGGTTATTACTCTACACTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTA
CGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTACAAATGGGCG
CGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGAGAGTGTTGGC
AGTCCATGTCTTTGGACTTCGTGTTCGGTCTTTCACCGGACGTCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGATACATCTT
GCTGAAGCAAGATGATACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACTGCACGTCTGTTCGTCGACATGGTGTTTAAACACCATGGCAT
GCCGATCGACATTGTGTCGGGTCGAGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCG
GACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTATGCTCACTCGTTCCAACACTGGAGCGAGTGTC
TGCCGATGGCGGAGTTCGCCATCAACAACTCGGCGCATGCCTCGACTGGGCATACACCATTCTACGTGAATGCCATGAGGCACCCACGCCTCCCGAGTCT
ACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTCCGACTGCACCGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGAC