Description :
From Genome Similarity Track
Location :
scaffold_176:36134- 43692
Transcript NameFunction/comments
g5153.t1hypothetical protein
g5154.t1 conserved hypothetical protein

Sequence
7558 bases(100 bases per row)
GACGAGTACGTGGATGGTTCCATCTTCCGCGTGAAGCTGCACAACTTTCTGACGTACTCAGACGCCGAGTTCTTTCCTGGGCCGCGTCTGAATCTGATTC
TCGGCCCTAACGGAACAGGCAAGAGCTCCATCGTCTGCGCGCTGTGCGTTGGCTTGGCAGGCAGCACCCGCGTATGTAAAACCCTAGACAGATCACTAAT
CTATACACAAGTATTAATCGCAGTTGGTTGTTGCTGTAGCTGCTCGGACGAGCTGACAAAGTAGGGCAGTTCGTGCGTCACGAGAAGGAAAGCGGCTACA
CAGAGATTGAGCTATTCTTCGAACGAGGTAACAAGGTCATCAGACGCAATATTTTCAGAGACAACAAGAGTACATGGCAAGTCAATGGCAAGGACTCGAC
TCTGAAAAATGTGGCTGGGATCATGGAAACCGCCAACATCCAGATCGACAACTTGTGCCAGTTCCTGCCACAGGACAAAGTGGGCGAGTTCTCTCGCATG
AACGCGGTGCAGCTGCTCAAAGCCACGGAGAACGCAATCACGGACAGTGAATTGGCAGCCAAGCACGACGAAATTGTTGAGTTGCAGCACAGCATGTCGG
ACAAAGGACGGGTAGGCAGTATTTCAACGGGACGTAGGTTGCTGCGATACTGATAGAGGAATGTGTGGTGGTGCAGGAACTGGAGCATGCCCGTGCAGCG
TTGGAGTTAAAGAAGAGTGAAAACGCGCAGAGACAGAAAGAGGTGGAGCGCATTGAGGACTACGAAGCGCGCATTGAAGAGGTGCGTACTGGTAGTTTGT
GTGGTGGCTGTTGAGATTAAGGCTTAACTGGTCGTGGTACTTGCAGACATCAGTGATGGAGAAGAAGTGCTTGTGGCTTGCGTTTGAGCAAACGAAAGCC
GAAGTGGGAGAACTGAAGGAAGAGAAGATCCGCTGCAAGCAAGCCATCACGGTGGGTATTGCTTATTGTGGCTAATATTTCCTATGGAGGCACTGATGAT
TTTGTGCATAATGTTGCTCTACTGGTGTAGAATGAACGCAAAGAGAAGATCGATCCTCTTATCGAGCTACTAAAGGATGAGCAGAATAAGCTGGAGAACG
TAAAGACCGAGTACGTGGAGGTATTAACGTGACTTGAAGTGGGCCGATTTTGCTAATCAAAAGTGGTTTGTGTTCAAAATAACTAGGAAGGCCGAGGTGG
ATACCGAAAAGCGTCAGCTCATCGAAAAGATTCGACAGGAGAAAAAGAACGTAAGTGAAGCTCGCACTTCGGTGCTTTCGTTGGAAGCAGTGCAATGTCT
AACTTTTGTATGGTGTATTTCAGATTGAGTCGATGGAAAATGCCCAGAATCAAACTTTGTCGGATGTCAAGGAGTTGCGCAACCAGCACAACTCCACTCG
CCGAAAACTCGAACGTTTGGAGCGCGATGTGGAGGAGGTTTGTACACCAGTATTTCTGTTCTTTTTACCGTTGACAATGACTGATTATTGCGCTACTTGA
TAAATGCAGTGGAAAAAGGAGCGTGAAGGAATGGCTGATGATACTAAGCTCAAAGAGCAAAAGGAGAAACTGGAAAGAGAGCAGCGTGCCAAGGATATGG
AGGTATGCATGGATGCAGTAGCTGCACGAATATCTATGGCAAATTCCTAATGTTTTGTTGTCCGCATAGGAAACCGAAATCCGGAGTAAGCGAGAAGCTC
TTGCTCGCGAACTATCCTACATCGAAAGTGAGCAGAAGAAGGTGAAACTTAAGATCGAGAAACTTGATAACGAGGATGTCCAGCGGCGGTTAGCTCTTCA
GAGATTTGATCCCGACTCAATCCGCGCTGCAGAATGGGCCAAAAACAACCAACACCGGTTGAAGCGGAAAGTATGGGGGCCCGTTGCTCTCGAGGTATGC
TTGTTTGTTGCTTCATTCTACTTTACGTTTTGTCGTGGATACTTACGGACACCACATCCCCTCTACCTACAGATGAAGCTAAACGAGATAACACATGCGA
AATATGTCGAAGACACCCTCCCAAAATGGGTTCTAGGAGCGCTAGTAACAGAGTGCTACGATGACTACAACACAATTCTCCGCGAAATCAACAACGGGTC
TGACCGCCGAGTTAAGATCTCAATTGTGAACGTGGAAGGAGGAGTATGTCGCGATATCCATCGACCGTACTCGGACGAGAAGATGAGAGAGTACCGCGAC
AGATATGGCATGATGGGGTTCCTGGATGAGGTAAGTGTATTAGAGCTTTCGCTCAACTGCAACGAAAGTGAGCGGGTTTTAATCGCTATTATTGATGCTG
TGCAGCTGGTAACTGCGCCGGACATTATTCACGAAGCTCTTCGCACTCAAGCTGGTCTGCACACCGTCATGGTCGGATCTCAGAAAACAGAAGACATTAT
CAACAGAGGCGGGCAGATTTTCCAAGAGATCGCGTCGGCTGAACGAAAGACTGCGTTCGTGACCCCGTATAAGAAATACGTCACATCAGGTACGTGTTCC
ACAACAACAATTCAGGCATTTGCACAGACTAACATCAGTTTTGAATTGCTCACAAGTGTCCAAGTATGGAAACCGAAATGTGACTACGCGTACAAACGAC
CTCATGAACCCTCGTTTGCTGGCGACCTCCACTTCCAACGAAGACGAGAAAGCTGATATGACAAAAATCTTGGATGAATTGACATCCAGGGAGAGGAGGA
TTCAAGACGAAGTAAGGCGTTAATTCTTAGCCTCGCTCTGGCTATGTGTGAAGTCTGACCATTGGAACTTGAATTTCTTGCAATTTCAGATCACTCACCT
CAAAGGACAAGAGAGAGAGTATGCTGAGGAGAAAAGAAACGCTCAGCATCGTATCACAGAGATTCGTTCCCAGCGGAAGGCAATCATTCGTTTGGATGAT
AAGATTCGCGAGGGTGCCAACAAGATTTACTCGCTGCAGAGTGAACTAGCACAGGTGAGTACACTTTTTTAGTTGCGATGCTATCGATTTTATGCTTACA
GTTTCTCTGTTTAGGATGTGTCGGCGAAGGAGGAGTCGTTAACTCGAAAGTTGAAGAACCAAGCCTCCAAGTAAGTTAAACACAATAGTTATGGGTCGTG
TATTGGTACATGTACTTACACGTTAATGTTGTCGGTGCATCAGGCAAGCCCAACAGATTAAACGTTGTCTACAACTGTCAAGAGATCTGTTCAAGGCCAG
CGCTCAGGAGGCATGCTTTTCTCTGCAGCTCGGTACACAACAAGTCCGAGTGGATTTCACACACAAGCACCTGAAACAACTGGATGCCACCTTGCGGTAA
GGACCTTCCTATTCTGTCGTCCTGTAATTTCACAAGCGCTGACACAATATGCGACAGGGAATTGAAGGAGACTTACAAGCTGGCTAAGAATAACCTGCTA
ACCGTAGCGCAGAAGGCAATGGACCTGAAACGCAAAGCAGAAGAAGAAGCCCCATGGGAAACTTACGAAGAACGTTTCAACGAACTTCCAGATGACTTGG
ATGAGCTACTGGGCAAAATTGAAAACAATAAGGCGGCTCTTGAATGCTTCCGTGGCGATAGAAGTATTCGTGAACTTTACGAGCGTGTGCGCGCTGAGAT
CGAGGACGATGAAGCGCATCTGGCAGACCTGGATAGCTTTGTTACCCACGGTGAAGACAAGATCAACGGTATCAAGGTACGATCTCTAGGATGGATTGTT
GGAGCTTGCGCCCAATGCTTACCCAGTCAATGTTGCCCAAATTTCGTGGTTCGGATAACAGGGTAAATGGCATGCCGATCTCAAAGAAGTGGTGGAGCAC
ATCGATACCTCGTTCAGAAAGTTCTTCCAGGATATCGGATGTGTTGGCGAGATCCTGCTGGATGACGAGGATCCGGTAGGTTATTTCCGAGCTATTGTTA
AGCAACAAGATGTATCTAACAATGTTTCTTGCGTGTACAAAATATTCAGGACGTATCAAAATGGGGCATTCAGCGTCGGGCACAGTTCCGTAAGAACACA
AAGCTGTCTACAATGACTGCTGAGGAGCAATCTGGAGGAGTACGTTTAATATCTCGATGTTGCTGAATGGAAACGCTCGACTAACTGGTTACGTTGCCTG
CAGGAGAAATCTGTTGGAACAATCATGTATTTGATGGCTCTCCAAAGCCTCACCAAGTGTCCGTTCCGTGTGGTAGATGAGATCAACCAGGGTATGGACG
TGTACAACGAACGGAAGGTGTTCCAGCGGATCACCAAGTCGTCGTGCGGTAGCAAATTGCCGCAGTACTTCCTCATCACTCCGAAACTCATTACTGGGCT
TACGTACCACCGGGACACAAAGGTCATGGTCATTCTGAACGGGCCGTACAACAAAATCCGGCAAGAGCTGTGGGACCCTGACCACTTTATTGCTCAAGCA
AAACGTAAGGGTGGCGCTCGAAGTGATTCCGCTAGGAAGCGAATTCGAGCTTGACCATGCCACGCGGATATTTCGGCTCGAGTGAGGTTGTTGCAAGTTA
TGTTGAAAGCATTTAAGATTCGTTCGTTTTACATGCCTACGCGTCTCATTTCATTGTTCAGAGTGAGAATTCTGTCGATCTACCCTATAAACACAGCAGA
TAAATCGCACGCGATACTCTACATGAAGTTGAATGCCGACTGCCCACCACTGAGGCGTGGGCCATCAGCAGCACCTGGAGGCGGAGCTGCGCCTGTAGCC
ATTCCTGCGCTCCGCGGCGAGTTGGCAATGGCGAAAAGGTCCTTTCCGAAATGGCCCAACGCCTTGTTGTGCTCATCTTGCTGGGGCTGCTGGTAATATT
GCTGCTGCTGCTGCTGTTGAGGGTAGGATGGTTCTGACGATGTAGAGTTTCCTAGCGTATCAAAGCCGTCAAGCAGCTGCAGAAAAATAAGAAAATGGTT
AAAACTCTTCTGACAAAAAGCAAAGCAATAAACATACCGAAAGTTCCTGCGGGGGTGCCGGGGCCGGTGGGGGCTGAGAACGCACAGGTGAGCCAAGAAG
GTCCGCAGTGCCCTGGACGCCATGATCGACTGGACCAGCAGACGACTCAAGACTAAGTGATCCAAAACCAAGAAGGTCTACTTCTTGCTGTGGCTGCTTC
GACATGCTCCTAGTGGGGCTACTGCGCTGCGCTCGAGATGATCCCGAGCGTTTGGCAGTTGGCTGAGGAGCTTGATCACTTTCGTTTGCATAACCAAGCG
CACGTAAAACCTGCAACGCCTTCGAAACAACACTTGGCTTCGCATCCTTTCTCATCTGTAAAATACGAACATCCACGCCATAATTGTACCTTGGTTAGCA
AGGCATTCAATGGTATAAAGAAACATGACAGAGCAATGCGTACCTCCTCGACGACTTCCACATTGGCCTCGAAAAATTCCTGGTAAGGTGCACCGCCTGG
AGAATCGAGTAGCGCTAGTACCACGTGTAGACCCTTCAAACGAACTTGCCAAGTATCGTCCTCGAGTTTATCGAGCAAGATGTCGCCAATAGTTTGTGCA
TCCAACGTCTGCGCAAGATCGATAAAACGTTTCAATCCATCTGCAGGCGGTGCACGCGAAAGCCCCGCAGGCGCGCATAAGCCGTCAATCATCGTACGCT
CATAGTCCCTATACACAACAATTCGGTGGTGAGGGCACTGTAAACTTATCAACATACTCCAATACAACTTCGTACCTGCTGGTATCGCCCCCACCAGCTC
CCTGCTGAGCGTTTGGCTGGTAGTAGCCGTGATCAATTACTTGCGGACCTGCACGCAGCTCGTCATTATCAGCCAAGGACGAAGCCATTGACTTGTCCAT
ATTGCGGCGGTCCCATTTTTCCAGAGCAGCCGTTCCCATCTTTTTCAATACCTCCGCTTTCTTGCCAAGAGCCGTCGTCGGGGCATCACTGAGTGGTTGT
CCGTTTACGGGAAGACCCATACTACCGATACGGTGGGTACTGCCGCTGAGCATGCGGTTATCATACGACGGCCCTCCAGACTGCTGACTGCCAAAACCGC
CCGACTGAGAACCTCCATAGCCACCTGACTGAGAACCAGACTGAGAACCGCCGAAGCCACCAGATTGGGCACCTCCAAATCCTCCCCGCGCACTACCTCC
CATGACATTCGGGTTGTATGAGTTTCCAGCGCTGGCCCCACGTACCATATTCGGGTTGTAAGTACCGCTGTTGAAGCCGCCTAGCCCCGATGTCGCACCC
GTGTTGCTATTACCGAAACCTCCTGTCGGCTTAGGAAAATTAAGCGAATGACCTACCAACACGGTAGGTCGATTGTCTCGTCTTGTGGATGGGTTGTAGC
GCGGCTCGTTTTCCGTCGCAGGGTCTTTCTTTTGATAGCCTGTACTGCTCCAGACACCGGCGCCAGTACTTTTCGAAGCTAAGCCAGAGCCGGACGCAGA
TGACCACGAGTTAAAGCCACTTGCCTGCTGCTGTTGCTGCTGCTGGGGCGCGTTCTGGCCATAACCGCCCGGTGGACCGTTCTGGTTGTAGCCATTCTGT
CCGTAGCCGCCGCCGTAGCTGCTGTTACCACCGCCTGGCGGTCCATTATAACCTCCAGACGGAGCATTGTACCCTCCAGCAGAAGGTGCGTTGTAGCCGC
CACCAGAGGGCCCATTATAGCCCCCTCCAGACGCACCGTTGTAGCCGCCGCCACCATTTGCTCCGTTGTAGCCTCCCGACGGGTTATCCTGATAAGGCGC
CGGTCGGTTCGAGGCCTGTGGCTGTCCCCACGATCCACCAACACTCGAGTGCTGTCGTTCAGGCTGGCCTCCCTGGTTATACGCTCCATTCGCGTTGTTA
TGAGGTGGCGGGGCGTCTCCCTGCGGTGCCTGCCAACTGTTCGCATCCTGAGGAGGCTGCTGCTGTTGCTGCTGCTGCTGAGGTGGCTCCTCATTACGTC
GAGACAGGAATCCATCGTTCAAGCACACCAGCGCTTCCTACATGCATCATACCACCAAGGCCAGTGAGCCCTTCTCCCCATCACGTGATAATTCCAAAAT
TCAAATGTTGTCCCAACCTGTGACGCCACCCGAATGCGGCGGTACTTTTCATCTCCATACACCGGATCCGGCGGGCCCGAAAACTCTACAACATCAATGA
AACACCGCGTGAGACCTTGAATAGCTCTCAATAGTTTTGCATCTTGCATTCCACGCACGCAAATAGGCTGATAGTTCCTGTTCCTCGTCCCTGATAGCCT
CCGTGAATGCCGGGCTGCCTTCCCTGATGCAGAACTAAACACTACGCTGTCAATATTCGTTCGAACAGCTCAATAAAAGGTTTAAACCCACCGAAATGAT
CTGCAACGCCTTCAGCTTGACAGTTAAGTTGCTCTTGTTTAGTCTCCCCAGCATGTAGTCGGCGATCTTCTCCGCATCGCGGTCGCTTGACTTGGTCAAG
TCTAACAATACAAACAATAAAAAGTGAAAATGAGACCTCTGTTATCGAGGCTGCAGCGGCAGTGGTAGCTGCTACTTACTGGCAATCTCCCCCATAAGAT
ATACGGGCACAGGACCGTCATGTAGACTCGTGGCCTCGGCCAGCGTGTGCCGATTCAT