Description :
From Genome Similarity Track
Location :
scaffold_197:3613- 7646
Sequence
4033 bases(100 bases per row)
TGAAGGTTAGgtccttcgagggtaaggatggagagaatccccTGCTCTGAGTAAGagaagccgagatggctatgacatctgccatgctccagaacgagca
acagcgcatggCTCTAgcaatctccaagctcgggggccgaaCGCAAGAATAGGCACTAAAGTGCGGTGCTTTggctgaagctgcgttctcctcctggaag
gagctgaagcatcagcttttgcgaatgttctcgccgcctaaccaggcatatcgcgtgcgatcgtgtTTGTTTGACGCCCgatagggcaagaaggagttgg
tggactttgtcgaaaaattgcgcactctcattaccGAGATGGCAGccaatcctctccccgaggcggctGCAGTGACCGTTTGAATGGAGGGCCTCTGCAC
TGGCATGGTCAAAGTGGAAGTCTTtcatgtgcatccgtcttcttttaaagAATCGCAAAATTTAGCATTGAATACCGAACTCATTTCTAAGTCggcgcga
cttggttggaagcaCAccttcagagctcgtcgaatgggcctgagccaatggacctCGGCTatgctgaagaagagaaggGAGAGCTTCGAGGtaccgagca
gcgtttaacacccgacggtgttttgtctgtggtgacacccgtcaccttcagactggttgtcccctgtgcaaggcgcgtaaaagtTCATCAAACGACGTTC
CGCTACTAACTAGCACGGAAAAACGAgaaaacccagtaggcgcggggcgcccaactggggaagaactgagatcTGTCGTGCCTCAAAGAAGTAGAGGGCA
GCacggcccagccccgaagagctcagtGCTCTTGTACACGGaacatgtatgcaagccgggcttgctggtcgtataaGCGaacgtgaagggctttgaaaag
ccacaGAAGACcctgatcgattccggggcgttggGCAATTATGATTGACGCACCAcgattgaaggaagtcagccatatgctaaggcgctgaaagcgcggt
tgagtacGCCGTaattgttcgcttagcgacaggTACTTGTGTCATTGtgtcgagggtccctgtggacatctgcgtcaagtttcttgactttaatagcgtg
gaacgcttttAGTCTtatacttggatgcaaggtatgaccttatccttggtgtgGCGTGgttagaacaccatgagccataaatTTATTGGAGTTCGAAGAC
CTCGGGCGCTACGCACAGGTCTCCTAGTAGAGCTTTGGTAAGCCATGAACTCACCTcggctaggaagcagaagcgctattggcgcgggcgcTGAACCaga
acggtcaatgtgctcgatatcggagtatgcgaattgtcgaacaccaaaggtgtttcggacaggagtcccgagcatggctcgcctgctgaacgtggagtgg
tacgtaacccactgagcgctgctcatgtATTGGAGCAGCCGCTGCAAGCCAAGATTGGCATGGTCGGTCAAGGgatgaggcatcgagggcaaagccctag
tgatgcacgtggagtggcacgtaacccccTGAGCACTGTTCGTgttacaaagcagttgctgcatgccaagagtggcttcatcggacgaggtccgaagcAT
CAATTACGAGGCCtcagtgatgcgcgtggagttgcacgactgagcactgctcacgttccAAAGCAGATGCTGCATACCATGCGTgatatggtcggacgag
gtccgaggcatcttggtcgaggcccttctgatgcgcgtggagtggcgcgtAATCCATTGTACACTACTCTAATTTTAGAGCagatgctgcatgccaagag
tggcatggtcggacgaggttcgaggcatcctgggctaggttcttctgatgcgcgtggagtggcacgttatccactggacgaagactgcagaaaaggcagc
tcttcgtcgaatgttgttaataacatcaaagctCCGATGAAGCaaggagtggggacactggacgacgccgagtgcgtgttcccactggtctcgatgagat
gatatctgcaaaacgaagggcgtcgaccctgactcaggacgtgtctaccgtaggcGGTAGCGTACAGCCATAGactcttgtcaacggtagacTAGAGAGA
AAGACGGAGACGGCACCCTCAAGGAtgtcccgcggtggatgctcttctctAGCTAGATgaaatgtccttcgaagagtttggcagtgccttggggcaggcg
atttagccgaagtggtcattgtaagaccaaacgaggagatGAAATTGTCGTcccttctggatgaagctgttctggaggacaccaagagagtgctgaacac
acgaactggatcgtcgatcctaaagGATCGCTCGGatctgtactatcctttgaaaaggaaatttcaagaaatcgtctctaaagacccgccgtcggtccta
catccggaccgaggtgtgagtcatgagattgacctggttccgggaaccaaatactgcgtaacacgctaatacccctgcccaaagagcagtgagACACCAT
TGTCGTCTTTTCCGtgagaagcacgacgcaggaatggtgtgtgagagcaagtctccccattcgacacccaaggTTTgtccccggaagccgaacggcaagt
ggcgtatcgttcacactcataataagctaaatacTACCACCATCTTAACACAGACTCCGACTTCTAGAAAAAAATTCATCAGAACagtatggttggctgt
acaaagtacaggcactcgacttggtcgattgctcatgagagcgagtgatattccgcagaCAACGGTGAGTAATCCAAGCGGGATGCcccgggagtggctg
gtgatgccacaagggctgtcaaatgcaccagcaacatctaaTCGTTTTGTGATGcaattgtttaggccccattaggcgtatgcacaaacatacttcaacg
acatctttgtccacagGCGTGCGGGGTATCGGAGGagagatgaggaaaaccacatcgcatatttgagagcggtgctctagtgcatgcgcacgaataagct
gtatgccaatGCCGATAGGTGCATCTTCGACGCGAAAGAAATCcactttttagggtgcttcgttgtgaagcgtggccttcgagtgaatttcgctaaggtc
aaggccactgtggacTGACCGGTTTCAAAAAAGCCAAAAGgagttgcgcaagtggcttggcttcgccaactacttgcccaagtatagcgcaaattatgcg
gaaatggcacggggcgagatcgggcgatcgcgttcaaatctcgccagcttaaggctgcggagaggacatacctagtccacgacaaggaactacttgtgat
gaagtatactcttgtcaagttcaaggcgcacctgcttggctcaaggTCGTTTGTGACCTTAACAGAGTAACtgagtcgcctcacctctcgcagaggatga
ccaggtggctctcagtctatgcagaatataacttcgaggtgtaGTAGAaaccagaaaagcagaatgctttggctgatgcgttgtcacgcagtcCGGATAT
CAcgaaggtgacgtcgtcagtgccggagttgatccgcgccgcatcgcgggtaatAGTATgtatgtagcgctgctacaggctctcgggagcaaggggtttg
gaaactcggacaagaaattgtcggcgcgtttgcgcgcatggatacaccgatatttgcTGAGTAACGGGtttctgtattatagcaccgatttgatGGATAc
atcacgaattgtggtatcTCGCGATGagcatttgaaataccgcatcatatatgaggcccacgatacCCCACTCAAATATCATCTTTtcgtcgtgagaaga
cgtacagctcagtgagttgccactatttgTGACCCAAGCcgtacaagtggacgagcacatgtgtgcgcacgtgtgagacatgtcagagGGCGAAACCCCT
CTCGTCGCTGCCCAGTTCactggtaccctccgggtgtttgcagcccatgagtatggactttgtgtttgatctgccgaaggactcagcgggcaacacgggt
gtggtagtctttgtggaccgtttgagcaagatg