Description :
From Genome Similarity Track
Location :
contig_114:3613- 6592
Transcript NameFunction/comments
g13902.t1XP_009525761.1 hypothetical protein PHYSODRAFT_247933 [Phytophthora sojae
g13903.t1RAW41826.1 hypothetical protein PC110_g2000 [Phytophthora cactorum

Sequence
2979 bases(100 bases per row)
CACAAGGCATGCTCACCATGCTGCAAATTGGCGTCTCGCTGGCTGTGGCGGCCATCCCTGAGGGCCTACCAATATGTGTGACTGTTACGCTCGCATTCGG
TGTGATGAAGATGGCCAAGCGCCATGCCATCGTGAAAAAGCTGCCTGCCGTCGAGGCGCTGGGATGCATCAACGTGGTCTGTGTGGACAAGACTGGCACG
ATCACGACGAACAAGATGGAGGTGATCGAGATTTTCGTTCCGTTTGAAACTGTGACCGCTGAGGTGAACGGTATTGGCGAGCGAGTGCGTTCTCCATCAC
AGACGCTAGATATGCCCAAGAAGAGCGCGCGTTCGGCTGTGACTATGCGTGGTGAACCCGTTACCGAGGAATCCCACCCCCATGTTTATCACTGCCTCCT
ATCCGGTGCACTGTGCAACAACGCGACTATCGTGGACCGAGAAGTTTTGGGCCAAGCTACGGAGGGTGCTGTTTTGTTGTGTGCGCAGAAGGTGGGGATT
ACCCCATCGGTCATTCAGCAATTCCGCCGTGTTAGCGAAGTTCCCTTTAGCTCGGAAAAGAAATGGATGGCAGTGTGCTGTGAGCCACCGATGGGGGGCC
CTTCTCGCTGGTACCTGAAGGGTATGACGGAAGCTATCTTGTCACGCTGCGATAAGATTGAGGATAATTGCGGCCGCGAAAAGGAAATGACCCCAGGAGA
CCGTGAACGCATTTTTGTGGCGTCCCAGCAAATGGCGGCACGTGGACTTCGTGTGTTGGCATTATCGTTCGGTGAGCACTCAGATCGTGGTATGGTCTTC
GCTGGACTTGTGGGAATCTCAGATCCGCCTCGTGCTGAAGTTGAGAAGTCTGTGTTGGAGCTTTCTCTGAGCGGGGTCAAGACTGTTATGCTCACGGGGG
ACTCCAAAGAGACGGCCATTGCAATTGCCACCAAGGTGGGCATCATTTCAAACGACCATTTCGGCAGCGTAGAGTGCGACGACGAGAGAATCAAGGCCGT
GGACGAACTAGTAATTTCTGGCCAGGAGCTTGAGATCATGGAGATGATGGAGTTGGAGCAACGCATTCTGAAGACATGTGTGTTTTACCGTACGTCCCCG
CGCCACAAACTGAAGATCGTGCGGGCTTTCCAAGAGGCAGGACTGATGGTAGCCATGACTGGTGACGGTGTGAACGATGCACCCGCTCTGAAGGCGGCAG
ATATTGGCATTGCAATGGGCACAAGTGGCACGGATGTTTCGAAGGAAGCGGCTGATATGATTCTGCTGGATGACAACTTCAGCACGATCCTGTGCGCCAT
GGAAGAGGGCAAGTCAATCTACCACAACATTAAGCACTTTTTGCGGTTCCAGCTCAGCACAAGCATCTCAGCCCTGTGCCTCATCGCATTCTCCACGTTG
TTCAACCTGCCGTCTCCGCTGAACGCCATGCAAATTCTGTGGATCAACATCATCATGGATGGACCTCCAGCCCAGAGTCTTGGCGTTGAACCTGTAGACC
ACGACGTGATGAAGGAGGGCCCGCGCTCCAAAGATGCCAGTATCATCACGCGTACGATGATTCGACGCGTACTTACGTCGGCTTGCTTTATCGTCTCAGG
CACCCTGTACGTGTTCTGGGTAGAGCTGAGTGATGACGGCATCATTAGCAAGCGCGACCGCACCTTGAGTTTTACGACGTTTGTCATGTTCGACATGTTC
AATGCGCTCTCGTGTCGATCAGACGACAAGTCCATTTTCGAGATCGGCATCTTGTCCAACACAGTTTTCGTGTACGCCGTAGGCGCCTCGCTGCTGGGTC
AGTTGCTCGTGATTTACTTCCCGCCACTGCAGGCCACTTTCCAGACCGAGGCACTGACGCTTGGTGACTTGGTGTACGTCTGCTGTATTGCTTCGAGCGT
GCTTATCTTCGATGAGATCCGCAAGTGGTGGCAGGTGCGCAAGCTGCGTGGAGCAATGCGCTCTGCGTCCATCGCCGCTGGCTTCAAGCAAAAGAAGAGG
AAACACTCGTGGGACAACGACACCGTGTAGATCAGAGAAACAGCGGAGCCCGTGTATTATGTTGACGCTTCATACCTGCCGCACACACGAACACGTGGGG
GCGAGCTGAATAGACAGATATGCCCGCATAACGCGTTTGGCCTCTCACTGCTTGTCAAAATAACTTATCGTTGTTCTATCGCAGCCTAGTCTGATGACAC
CCAAAGCTGCTGCATGGCCGCTTTTACGGCCTGAAACATGTCAACCCCCATAAGCGCGAGCGCACACGGGACGTTGGCGGGGAATATTGCTTTACTGCAG
TCCGCGTAGTAGCCACGAGCCGCAGCAAGGTCCTGTGGAACACCGTCGCCGATCAGCAGCATCAAACCGCAGTTGTAGCCAGCCTGAGCGTCGCCTAGTT
CCGCTGCAAGCTGGTAACGCTCAAGTGCACGCGTATGGTTGCTCTGGCAGACACCAGCCCAAGGCTCATGGAAGCATGCACCAGTCTTTCTAACAGCTTC
GGAGTCGTTCAGCGCCGCTGCCGACGAATACAAAGCGAACGCTTCATGCAGAGGAGGATTAGTTGAGTCCTCGGCAGAATCCCCAAGTCCCAGCCAGCGC
CACTTGAGAATGTTGTCACCGTGGTGCTCCAGCAAGAATGCTGCATTGCATTGTGCATCTTCGTCGCCCAGCTCCGCAACCAGCCGGTAGTGTAGATACG
CTCGCAGGAAGTCGCCCTTCTTGTAGCACTCGTACGCTTTGATCAGAGAGAATGGAAGTGCAGAGAGGAGGTCCGGATGCAGGGCAACCGTGCGGAACAG
CGGCAAAGCGGTGGAGCAAGACGGTGGGGTACCGACACCTTGGAAATGCATAACACCCAGATTGAATACCGCTTGGCTCGACTGACCATTCGTGCCATCT
ACAGCCGCCTGAAAGTGAGAAAAACCATATCATAGTCAACCGGAACACCGCCGTCCCCATGCAGATACGCTGAGCCTAA