Description :
From Genome Similarity Track
Location :
contig_24:361218- 362709
Transcript NameFunction/comments
g5424.t1ETO76951.1 hypothetical protein F444_07825 [Phytophthora parasitica P1976
g5425.t1hypothetical protein

Sequence
1491 bases(100 bases per row)
GCTGCCGTGCTCTGCAAAATGCTCTCCAGATGAGGGACCAGATGCGCTGGCACGAAATACTCCGCCGGCTTCTGCTTCTGCAGCGCTCGCCGTGCAGCAT
GCGCCACCAGCGCGCCGATGTGGTCGATGTGCCCGTGCGTGATGAAAACGTGCGATTTTCCGATCACTCGGCCGGCGAGGCATCCCAGGTCGAACGCTAC
ATCAATGGAGTCCACATAGCAGCAAGATTCGATGCCAGCCACGCAGCGCACGTGCAGCGTGTAGCCCCCGGTCACCACCACCTTCGGCTCGCTCGTGTAC
ATTTCGATGATGTACCGTGGCTGCCAGAAAACTGCCGCGTAATCATAAAGATATACCGTAGCTGACGTTAAGAAGGCTACTTCGAAGCTGAAAGCTGCCC
CTGGTTGTATTGTATTGAGCGAGGTTGTTGGCAACAACCTCTTCGATCAGGACTTACCTCACGACATCAAGCTGGCAGCGTCGTCGCAACAACCAGGTCT
TCGATTAGGGGCGGTCGCACCAACAACTTGTTGTACGCCGGCACAAATCTAAATCGGCAAAACTCCACACAATACTTGATCCTGTTGCCAGCGCCTCGCG
TGTGGCGACGTCGCAAGGTCCTTCTCCATCACTGTTGGCGCAGACCTTGGGAGTCTATAATCAAGGCTCGCATATGGACAGCGAGCATCCACCCGCACGC
GTTCAGAGGGAAGTTCGCGCAAGCACCAATCCTGCTCGAACGAAAGCTTGTACTTGCGCTCTTGCTGTTCACCACCCAGCAACACCAATGCACGCGAACC
ATGCTATTACAAGCTATTCCAGGCCTGTTGCGAACGCTTATTCCCATCGGCGCTGCCGACGTCGTCAATGCGATTCGCCTATTTTGACTTGACTACTTCA
GCTTCCATGCCACCTACGGTCTCTTGTACCTTTGACTCGACTTCACTATGCATGTCTCGGTCATTGGCGTGGGATCCGCTGAATGTGAATAAGTGCTCGC
CTTCCTCTGTCAGTCATTCCTCGACTTGCGCTGTGCACCAAACTGCAATGGTGTTGCCCTCTTCTTCGGCGATACGGCCGCGCCGCATCGCGCCCAGACG
CATCGCGCTGGTGCTGGCCGTATGTGTCCGACCTGCTGCTCACGGGGCTTGTCTTTGGCTGGGCGCCGCTGCTGCTGCTGCTGCAGGAGGAAGGCCAGTA
CCACGAGCTCTGCTCGGACCCGATCGAGTCCACGTGCGTGGCTCAAGAGAATCGCCTCAACCTCGTCTTCGCAGTGGCCTCCGTGGCCATGAACGCCGGC
GCGCTGCCTGTCGGTATGTTCCTGGACCGCGCAGGGCCCCGCGTGACCATCGCGATTGCTGCCATCATCGAAGTCTCGGGCCTGACAATGCTGGCGCTCG
CAGACTCGCAGACTTTCGACCTGTTCGTGCCAGCCTACGTGCTCATCGCGTTCGGAGGCTGCATCACCATGATGGCGTCGTACCCGGCCAG