Description :
From Genome Similarity Track
Location :
contig_24:361211- 362702
Transcript NameFunction/comments
g5703.t1ETO76951.1 hypothetical protein F444_07825 [Phytophthora parasitica P1976
g5704.t1ETK88114.1 hypothetical protein L915_07601 [Phytophthora parasitica

Sequence
1491 bases(100 bases per row)
AAATGCTCTCCAGATGAGGGACCAGATGCGCTGGCACGAAATACTCCGCCGGCTTCTGCTTCTGCAGCGCTCGCCGTGCAGCATGCGCCACCAGCGCGCC
GATGTGGTCGATGTGCCCGTGCGTGATGAAAACGTGCGATTTTCCGATCACTCGGCCGGCGAGGCATCCCAGGTCGAACGCTACATCAATGGAGTCCACA
TAGCAGCAAGATTCGATGCCAGCCACGCAGCGCACGTGCAGCGTGTAGCCCCCGGTCACCACCACCTTCGGCTCGCTCGTGTACATTTCGATGATGTACC
GTGGCTGCCAGAAAACTGCTGCGTAATCATAAAGATGTACCGTAGCTGACGTTAAGAAGGCTGCTTCGAAGTTGAAAGCTGCCCCTGGTTGTATTGTATT
GAGCGAGGTTGTTGGCAACAAACTCTTCGATCAGGACTTACCTCACGACAATAAGCTGGCAGCGTCGTCGCAACAACCAGGTCTTCGATTAGGGGCGGTC
GCACCAACAACTTGTTGTACGCCGGCACAAATCTAAATCGGCAAAACTCCACACAATACTTGATCCTGTTGCCAGCGCCTCGCGTGTGGCGACGTCGCAA
GGTCCTTCTACATCACTGTTGGCGCAGACCTTGGGAGTCTATAATCAAGGCTCGCATATGGACAGCGAGCATCCACCCGCACGCGTTCAGAGGGAAGTTC
GCGCAAGCACCAATCCTGCTCGAACGAAAGCTTGTCCTTGCGCTCTTGCGGTTCACCACCCAGCAACACCAATGCACGCGAACCATGCTATTACAAGCCA
TTCCAGGCCTGTTGCGAACGCTTATTCCCATCGGCGCTGCCGACGTCGTCAATGCGAGTCGCCTATTTTGACTTGACTACTTCAGCTTCCGTGCCACCCG
CGGTCTCTTGTACCTTTGACTCGACTTCACTATGCATGTCTCGGTCATTGGCGTGGGATCCGCTGAATGTGAATAAGCGCTCGCCTTCCTCTGTCAGTCA
TTCCTCGACTTGCGCTGTGCACCAAACTGCAATGGTGTTGCCCTCTTCTTCGGCGATACGGCCGCGCCGCATCGCGCCCAGACGCATCGCGCTGGTGCTG
GCCGTATGTGTCCGACCTGCTGTTCACGGGGCTTGTCTTTGGCTGGGCGCCGCTGCTGCTGCTGCTGCAGGAGGAAGGCCAGTACCACGAGCTCTGCTCG
GACCCGAGCGAGTCCACGTGCGTGGCTCAAGAGAATCGCCTCAACCTCGTCTTCGCAGTGGCCTCCGTGGCCATGAACGCCGGCGCGCTGCCTGTCGGTA
TGTTCCTGGACCGCGCAGGGCCCCGCGTGACCATCGCGATTGCTGCCATCATCGAAGTCTCGGGCCTGACAATGCTGGCGCTCGCAGACTCGCAGACTTT
CGACCTGTTCGTGCCAGCCTACGTGCTCATCGCGTTCGGAGGCTGCATCACCATGATGGCGTCGTACCCGGCCAGCTTCCTCATCATGCGC