Description :
From Genome Similarity Track
Location :
contig_37:361011- 362423
Transcript NameFunction/comments
g7628.t1conserved hypothetical protein
g7629.t1hypothetical protein

Sequence
1412 bases(100 bases per row)
GAAGCAGCTCCTGCTTCCACATAGCGAGCATCTTGCGCAGCTCCGGCTCCCAGGCACTCACCACCTTCTTTGCGGCGAGTTCGCGCTGGCTGCTACCGTT
GGTTGAGACGAGCACCTCATAGTCGTCGCCGCTCGTGTCGTCAAAGTCCTGCAGCTCCACATGGCCCGATACATCGTCACTGCCCTCCCACGCGAACTTG
ACCGACAGTTCGTAGCCGCAGCGCTTTTTGCCGCGACTAAAAGACGATCTTCTCAAAGCACGAAATCTCAGCCACAAACCCCTCTTCAAAACACTTTTAC
CCACTCACCTTCGCTTCACCGTCACAACGCACAATGGACGTGGCCTTGATGGACAGTCCCTGCGCCTCGTCTTCGAAGCTGAAGGCCGTGAGGATGTGGT
GTTTCAGTCGCTCACGAGCCCACTCGGACTTGTCGCGCTCCTCCCTGCAGACACCAGTTAGAAAAACTCCTTCCCCGCCGACACCAACCAGTAACTCCGC
AGCGCACCAAGTGCCTGCCGCATTCCACACGGAGCTGGAGTCGCTCCGATGCACGGGAGCCGTCACCGCCGCCGAATGGTCGATCCGCACAGGGGTGAAG
TCCTGAATCCGCGGAATTCCAGCACCAAAAACAGCATTTTAGTCCCCATTTCAGCAAATTAATGCTACTACACCCGCACCTGCGACGTCTTGGGGATCGT
CTTCATCCAGCCGTGGTACCCGCTGTGCATCTTGGGGGCGTCTTCCTCACCGCTCGACATCGTATCTGCTGGAATATTCGATAATGACGCCGCATTCACG
TCTTTTCATCCAATCACCTACCTCCACTCTCCTCATTCGTAAAAATCAAATCATCATCTACCCATACATTAAAAAAGGTAGAGCGCCCTACCATGCCGGG
TGTCTGGAGCGCGCACGTGACCAAGGAGGGCCGCACATACTTCTACAACCGCACCACGAAGCAAAGCGCGTGGGAGAAGCCCGAGGACTTTGACGGAGAC
GAACCCCCTGCCCCCTTTGGCGCCAAGAGGCTCGAGTGGGAGGAGCTCTGGGACCCCAAGAACGAACGCGCCTATTACTACAACCGGGCGACGCGCAAGA
CCCAATGGCAGAAACCCGAGGGCGTGGAGATCAAGCCCCGCGCGGGAGCGAGCGACAAGAAACACGACAAGCACCGAACCAAGGCCAGGAAGGGCGACGA
GAACGGTTCTACCCCGCGGGAGAACGAGCCTACCGAGGCTGAGGAGAGCAAGGCTAAAAGTAGTCGGGAGGAGAATCAGACGCAGAATCAGGCTGAAGAT
CCGAATCAGACTCGGAACGACGATGTTAATGCACAAGAAGCAGCGCCGACGTCGACGCATAGCAAGAAGAAGAAGAAAAAGTCCAAGAGGGACAAGGCGG
ACACTGCGGTGG