Description :
From Genome Similarity Track
Location :
Scaffold_1404:361- 4172
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1404-fgenesh-gene-0.0Nucleolar protein
Pytar_ATCC12531maker-par_contig_1404-snap-gene-0.530S ribosomal protein S16

Sequence
3811 bases(100 bases per row)
AGGAGGTGCCCCGCCATTTCGACCGGACCCTACACCTCGGTATAAGAGTGTCGTAGTTAACGTAGTATACTTGTTTCTTATAAACGAAGTTTCAGTAAGA
GTGGTTATAGTGAGGTTCTTGAGGTTGACCCGTGAACCCATTTTCCCTGGCTTCTGGGGGGGAGATAATAACCGTCGCTGCGGGTCGGGTTCCGTGGGTT
CTCTGGATAACCCAGCCCATGGGTTGTATCCGCTGGCCCGTCGTGGGATCCGCAACCCGTGAACCCATTTTGCGAGCAGCTCCAAAGCGGCGTTTCCTGG
TGATTGGCGTCCAGTCGAATTGAATAAGATGGGACCGTTCGTGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGGGACCGAACCCGTTTGATGTGCGCTCGAACGCCAAGACCAAGTACGAAGTGC
TGGGCCGCCGCGTCAAGGGCACGGGCCGCAACGTCGCGGCCGCGCGCGCCGACGCCGAAGCCAAGCGCAAGAAGTCGCTGGCGTCGCAATTCAAGCTGCG
CCACAAGGCCAATGCGTTCCACGATCGGCGTCTCGGCGAAACGAACCCGGAGATGACGCTGGAAGACAAGATGATGGTGCGGTTCCAGACGGAGCGCAAG
CGCAAGATGCGCAATGCGCAGGCGTTTGCGCTGCAGGACTCGGACGACGAGGACCGCGACGGCGACGAGCTCTTCCTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCACGGCGGCCAAAAGATTGACGACTTGGAGAAGCTCCGCGGCGAGAACGCGTTTGGTGACGAGCGCGACGACG
ACGACGACGAGACGCGGAAGATGGACCGCGAGATCATTAGCAAGCTCCACTTTGGCGGCGGTGGCGAGAGTGAAGGGCCGAGCGACCACAAGAAGACCCA
CAAGGAGATCATGCAAGAGGTCATGGTCAAGTCGAAGCTGTTCAAGGCCGAGCGCCAGAAGAACAAGGCGGCGCAGGAAGACACGACTGAGCAGCTCGAC
GAGGACTTTGACAGTCTCAAGAACCTGCTGTCGTTCCGTCCGACGAAGGGGACGAAAGAGTACGACGAGCTGGTGAAGGAAGAGCGGAAGGCGGCGCCGC
CCGACGAGTTTGACAAGCTCACGCGGGAGCTCACGTTCGAGGCCAAGGCGCAGGCGAGCGAGCGGCGGTTGTCGCCCGAAGAGGCGGCCAAGCGCGAGCA
CGACCGACTGGCCGAGCTCGAGAAAAAGCGAATTGCGCGCATGAACGGCGAGGACGACGACGACAGCGACGACGAAGGTGGGAAGAAGGGCCGCAAGGGC
AAGAAGGGGAAGAAGAAGGCCGAGATCGTCATGCTGCCGCCGCAGACGGACGACGATCTGGCGTTTGACTATGCGATGGACCAGCAGTTTGGAGCCGTGC
AGGAGGAAGAGGAGGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAGACGAAGACGAGAGCAAGGCTGCCAA
GAACGCCGAGCGTCTCCGCAAGCGCAGCGAGGCCGCGGCCGAACTGCCCTTTGTCTTTCCATGTCCCGAGTCGCTCGAGGAGCTCACAAAGCTCTTCAAG
CAGCACGCGTCTGGCTCGTCTGAGCGGCGTGCACTCATCATCGAGCGTCTCATCAAGTACTATTCAGTCAAGCTGAGTGCCGAAAACCAGCCCAAGATGC
GCAGCTTCTTTGCGATTCTCGTGCGGCAGTTTCTCAAGTGGGCCAAGAGCTACGCCGTCTACAAGTCGGATCTCGACGCGTTGGCGCGCCATCTCTATGT
GCTCGCGCAGGACGTGGGGGATGCGGCCGGCGTCGTGGCGCGGGAGCTGCTCATTACAATCCACAAGCGACTCCACAGCACCAAGGCCTCGTCCAAGTAC
GCGACGCTCGCCGAGCTCTTGCTCTTCCAGGCGCTGACGCAGATCTTCCCGACGTCCGACTTGCGCCACAACGTGGTCTCACCGCTCGAGACGCTCCTGA
GCGAGTCGCTCGCGCGCGGCGGGATCGAGTCTCGCAGCGACGTCGTGTGCGCCTTGTTTACGTGCACGCTGCTGCTGCAAGTGACGAAGGAGAAGCAGCG
GTTCACGCCCGAAGTCGTCGTATTCGTACGCAAGCTGCTGCGGGTCTTTGCCGTGGGCGAGCCGTCCCACTGGCTGCGCACGGAGCTCGTCGAGTGGCTC
AGTTCCAACGCAGAGGGAGAGCTCCCGGCACTCGCACTGGGCGAAGCGTCCACCGCGTCGTCCCCACAGGTGCTGCGTGCGCTGCTCGCGATCGTGGAGC
TCGTGGTGGCGCAGTACGCGGCGCTGCCGTCCGTGGACGAACTGCTGTACCCGAGCTACTTGCTTCTCCACGAGATTTCGCGGTCGCTGCTGCCCAAGCA
CGGGCAGCTCCTCGCCGTCATTGCGAGCGTCCACGACCGCCTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGGCAGC
AGCGCGAGCCGCTGCGGCTGCAGACGTTCGGGCCCAGCGTGCTGCCGGCCTTCACGCCCAAGTTCGACGCCAACTACACGGTGCGCAAGGACAAGACGCT
CGACCGCGACCAGGCGCAGACCAAGCAGCTCACGCGCCAGGTCAAGCGCGCGCGCAAGAACGCGGCGCGAGAGCTGCGGCGCGACGCGTCGTTCCTCGCG
CGCGAAAAGCAAGAGGAAGAAACGCGGCGCGTGGCCGACAAGAAGGACAAGCAGCGCGAGATTTGGAAGTGGCTCGAAGAGCAGAACGCCACGTTCAACC
AGCAGGCCAAGAAAGGAGGCGAGATGCTCAAGGGCGGTGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGCG
CAAGCAGTAACCACAGACAGAGAAGCACCTTGTTCCTACACTGTGAATAGACCCATGTATGTATCCACCTGAACCGAGGCGAGCGGCTACGATCCATGCC
ATTGTATTGCGTTCTTTCTCCGTGTCTCCCATGCGCTGTGTGCTCCTACAGGGGCTCTTACTTGGCCGCGCGGTCTTTCTTGGGCACGCACTTCTTCGTG
TACTGGCGCGTGGGCGGCGCCGGCAACACGTTGGCGACGCCCAGCAAATGCGCCACGCGGTCCGACGGCTGCGCGCCGACCGAGATCCAATACCGCACGC
GCTCGCTGTTGACGCGCAGCTCCTTGACGCCGTCGCTCGCGGCGATCGGGTTGAACGTGCCGACCTATAATACAGCGGAGCGTCCATCAGTCCATGCCAT
GGGGGCTCCAATAACGAGAGAGATCGCGTTGGAAAACGCACGATTTCGAGGTGCTTGCCGTCACGCGGCGCGCGCGCGTCGGCCGCGACGATGCGGTAGA
ACGGGAGGTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCCCCAGCGCGCGAGCCGTAGTCTCACCACCATGGTCTTGTTCTCGTCTCTCTTGCCACC
CGCTGTGTGTGGGGGAGATTGCTCAAAGCGACACCAGTGGTCGAGTATCGAGGAGCTCCACCGTCTTTTGGTATCGAACATACCCTGTTCTGAGATATTG
TGTTTATTTAA