Description :
From Genome Similarity Track
Location :
scaffold_314:361- 35131
Transcript NameFunction/comments
g7156.t1 transient receptor potential Ca2 channel (TRP-CC) family protein
g7157.t1 hypothetical protein PHYSODRAFT_566381
g7158.t1 hypothetical protein PHYSODRAFT_533462
g7159.t1 hypothetical protein PHYSODRAFT_289190
g7160.t1 conserved hypothetical protein
g7161.t1 hypothetical protein PHYSODRAFT_289191
g7162.t1 conserved hypothetical protein
g7163.t1hypothetical protein
g7164.t1 conserved hypothetical protein
g7165.t1 hypothetical protein PHYSODRAFT_307593
g7166.t1 hypothetical protein PHYSODRAFT_532805
g7167.t1 hypothetical protein PHYSODRAFT_532805
g7168.t1 conserved hypothetical protein
g7169.t1hypothetical protein

Sequence
34770 bases(100 bases per row)
AAACTGCTACCCATCTGAAAATGTACGAATCTGAAGGCCCAATCCAAATCAACTTGTACATGGCGTCCCGGATGTCGAGGCCAAACAGCAAAAAGATCGT
CGCACACTGGTATAGCATTCTTTACTCGTTGTCAGCGCTTGACATAAGTACCCTCAGTCATGATTCGTCGGCAGCCACTGCAGGTGGACCTAGAAATTTA
CCACTGCTGTTGAGGAGCAAAATTAAAATACTTGGGGACAGCCCAGTCAATTAATAAATACATGCACCCTTCTGTCAGCCAACACTTGCACGAGGAGGAG
GCTTACGACTTGATCCATTGAAAAGCCTCGAGTTCTGCAACAATCGACGAGCTGCGGCTTGAGCCACTGGACTCGATAGCAAGGACACACCAGCTCCACT
GGGACGAAATTCATCCCCATCACCCGAGCGCAAGTCGTGCAGTAATTCTCCAAACCCACGGCCATAACTGATGTCACTAGAGAAGATGTACGCTCGGCCC
TCTCGCTCGAATAACCTTCCCAACGTAGAATCCACACCTCGAGGCCGTTTGGAGAAGTAAATCGGTACAATGGTCTTGCCTTTATCTTCAGCAAACGCTA
ACTGGTCACTGACAAGCTCAGTTTTCACACTGCGCTCTGACAGCACCACAAGAAACACCGAACTCTGCAGGATAGCGTCCTTCGCCGCTAGAATCCGCTC
CTTGGTGCTAGACACGTTGGTCATCGAATCAACCACGAATGGCAACTGGTGACGCCGAAGTTCGGTGCACAAACGCGTCACGAAGTCACGATGACAGTCC
CCGTGCGAAACAAAGATAGAGAACGTCGGTCCTCCTCCAAATGTATTCCTCCTTCCGCTTCCACGCACGATAACAGCGTTCACGATCTCGTCCAACCCTC
GACGCCTCAGAGTCGCAGCCCTCCCCAATGGCTGGTGGTTGCTTAGAGTTGTTTGAGCCAAGTCTCGATCACCTTCAAGCCGATGAATCTCCACTTCGTC
CCGTAAACCATCGATGAGGCTTCTGAGACTAGCCTGGAACTTGTCCTCATCAATTTCAAACTCCACGTGGTCTACAGCCGATCCTTCCGATACTGTAGAG
CCGTCTTCACTGGATTCTGCTGTCTTAAAGTGATGTGACGTCACGGCCTGACCGAACGGGACGATCTGCCGGGTGAAAACGAAAACCTGCAATTCCTCCG
ACATTTTTACGGATTCGCAGGATATCGGAACCACTGGAACCTCATGTTGCTTGGCGAACGCGAGTTCATCCATGCACAAGACGCTTTGAGCGTATCCGTC
GCTAAGCATGCAGACGATTGCAGAGGCATTTTTCATCACTTCCAGCGACTTTTCCGACGCGCCACCACCCACTCTTCCCACAGTATCATCCTCTTCGCTG
CGCATATACACCGTCATGAAATTTTGCTCAATGCCAGCACGCACACGCTCTGCAAACTTGCGAAACACTGGGTCGAACGAGAGTACAACGTCGACACAAC
CACCGGCGACTTTCACTGCGTATTGCAACTCGGCCGACGCGCAGCACTCAACGGCACGACGCCCTTCTCCGTTCAGCGCGTACAGATCGGCTTTGCCTTC
AACGAGCAAGGCTAGCGCAGTTTCTTTATATCCAAGTCGTAATGCGATGTGCAGAGGGGTCTCTTCTACTTCATTAGGAACGATGGCATCGACATCAGCC
CCGAAGCGGACAAAAAGCTCCACACAGTCACCTCGCAGCAACCCGCCATCAACTGCAAACGCCAGTGGTGTCAGTCCGTCATAATCCAGTTGCAAGTAAT
CTGCATCCACGGCAAGAAGCTCTTCGACTGCCCCAGCATAGTTATGACGGGCTGCCCAGTGCAGAGGTGTGCGCCCATGACTGTCCTTCGCATTGACGTC
AGCACCGCGTTTAACCAGTTCACTAATCACTCGGTGCCTCCCCATCACGGCGGCCCAGTGTAGCGGTGTCCGACTGTTCGCTCCGCGCTGAAACTCGCCC
AGAATGTCAGCGCTGATACCCCACGACAGCAAATGATGCACAGCTGCAAGATTCCCAGCAGCTACAGCCTCGTGAAGTGGAGTCAGCGCAACATCAGCAC
CCCATTCTTCCAGCACCGTGGCTAGTTCACGACGACCAGACAGCTGAGCGCGTTGAAGCACTGTCGTGCTAGCGGCATTGCCACCACCCGGCACTAAAAG
AATATTCGCCCGGTGTTGTATCAGGCACTCCACAACGTCAGCCGAATCTGCGAGGAAGATGGGAGTGACGCGCATGGAGCGCGAGAAAAAACTCGATCGC
GCCAAAATGTCCAAATTGGCTCCGTACTGCACCAAGAGATCAATAACTTGTGTGTGACCGTGCAATGCAGCCACATGCAGCGGCGACCCCAGGATATGAG
TAACTTTCTTCACGCGTAACTGGCACAGCTCATACAGCAGCTCCAAGTTGAAACTGGCGCCAGAGATTTTATCTAGAAAATTGGGGTTCAAGCCCGCCTC
CAGCAACACTGATACAACGCGAAAGTCTCCGGCTCGACACGCCACATGCAGGGGGTTGTGCGTCCGGTGCGAAAACATCCAGCAAAAAAGCGATGGCGTC
GTGTACATCCGATTGAGCAACATGTCGAGCTGCACCTTCGACCCAAGCACGTGCTCTGCTCGCTCCAATAGTTTCTCCACTGCGGCGCAATTCCCACTCG
CAGCCGCATCGTAAAGCGCGCCACGCAGTTGTCTCTCCACCGTTCGAACTGTTCCCTGCGTCGTCGCCCACGGGTGCAGCTCCTGGTTCAGCGTCAAGTA
CGAGTCCACGTGATTCGACTGCAAGATCGGTGTATGTACACCACTTGTACCAGAGCTCTTGCCCACAGAAGCCTCCGATCCGCCAGAATTTACTCCAGCC
AGAGCTGTGGGGGCCACCGCCATCAATTCATCGTCCTCCAGACCAGCTCCAAGCTGCAACTGTTGGTGTGCACGGAGCTTGTCGAACTGCTGCGTATGCA
GAGCAATCGTGAGGATTGCAAACAGCGTCACGTACGACACGGGGTCCAGCCAAATTTTCCACACTCCGTGCTCCGTAAGCTCTCCGAAAGCCCAGTAAAC
GCCGAGCATCAGCACCACAATCCACGTCAGCGACACCGTCTGCACTACCACAATTGCCTCAAAGATTGCCAGCGTTAATGTTCGTTCCAGGGTGACGCCG
GGCGCGTCAAAAGCTGAGCGGGAGAGCGAGAAGGAGCTCACGGCCCTGGTGCCCAGGAGCTGCTCGCTTGTAGTGGCTGCTGTGGCGGACTCTTCGGTAT
TTGGGGGCGCAATTTCGCGCACACGATACAGAGGAAAGAAAGGGAGAGCTGCCAGCCCCAGCGATACGTTGAGCACCTGCAACGCGAGCCAAATGTCCAG
CACGAAACCTTGGGAGCTGGTGAAGAAGAGCAGCAGGAGGGACCCGAGGGAGAGCAGCGAGGTGAGCGCCACCCGCCACGTGTAGTACGAGTTGGACCAC
TGCAGACACGCGTCGGCGCCCCGCCACCGTCGCGAAGGAGACGAAGGCGGCGGCGCGTCCGCGGCTTCGGCTTCGGCTTCGGCTTCGGCAGCCATTTCTG
ATGTGTCTGCTGGATGTTCCGCCATTGCGGATTTTGCGCCAATCAGAAGTCGTGAATGGCTTTTTTGATTTTAGTAAATGGATCGATTCGGCATAGGAAC
TGCGAGGAGAAAGTAAGCTTATGGCAGTGAATCCAGACGGGCATCAGCTACACTTGTATCATTGCTGTTATCTGCAAGTGTAGTGCCTACTTGGCTGAGC
GGCAACAATTGCTACGAGTCGGAATTGCAGCATTATGAGCGAGTCGCTCAGAGCGACAGTACATGTACCGAACTACCGGTACAATATCAAATATGGACGG
TAACAGCTGGCTTTATGGTCCCACGCATCCACCGAACATATCGGCAAATTGGACGATAGACTTCTCTTCATCATTGTTGCGCAAGCATTTTAAGTCCCCA
TTTTCAGCGATGGAACTGCATACCATTGTATGCGCGCACGCAACCTGCCCTGTGAGCTGTTCGACTTAGTGGTGGGTTTTCTTTTGCGAATCTTTTGGTA
AACACGTTGAATGAAGACACATGTCGCCGCTCGCTCGCGATTGGCGCAATGTTTTATATCCAATCAGCGTCGACTGCCTCGTCTGCTAGACAGCCAGCAA
CTCCGCAACACAGGCGAGTCACAGTGTAGCGGACCTCGACAGCAGTTTTCCTGCATACAAAGGCAGTCGGTCAACCAATCGACTGAACAACGCGTCGCTT
TCAGAAGGAAGAAACACAGGACTAGGAAGAGCGCACACGTCGCACACGCAGCGTGTTCTCTCGGTCTTCACAAACAGCTACAGACCACAGCACCCAGACT
CCCAGACGCACCGCTCACTCAGCTATTTACCCGAGTCTTTTACTCCCGAAACAGCCCAGTAGAGCACAAGAAAAACAGGTTCAAACCGGCCATGGCCAAG
CGCATTCGAGTAACGAAGCAGGAATCTCCCGCGGACCTCATGGACCCATCTCCAGCCCCAGCTCCACCTAATGCTGTAGCCAAAAGCAAAGCAGCGACGC
CCACGCACGCAGAGGGGAAGCACGTAATGCTGCCTGCGTTTCTATCCAAGACGTACGAAATCTTCAGCATGCCCGAGTTCTCGCACGTGTGCGGCTGGAA
CGCCAACGGAGACACGATCATCGTGTCGCAGCTGGAGGCCTTCGTGGCCATGGTGCTGCCTCGCTTCTTTAAGCACCGCAACTTCCCGTCTTTCGTGCGC
CAGCTCAACCTCTACGGCTTCCACAAGACGGTGCTGGACTCGAAGCGGCTCGAGTTCCAGCACATGTACTTCAAGCGTGGCCGCCCTGACCTGCTGCACC
ATATTAAGCGCAAGGTCTCGAGCAGCAACCACCACAACCAGCAACTCGTCAGCTCCGCGCAGGTGGGTTTTACACAGTAGAAACTGGGTTGAGAAAGGTT
TGTGCTTATGATTTGATATGTGTACAGAACTCGCGTCTTGACGCCCACCGCGAGATCTCAGACACGCTCCTAAGAGAGATGAAGGAGCTCCGCCAACGCA
GTGACGCTATGGAGAAGCGTCTACGTGAGGTGGAAATTGACAATGCGGTACGAGGAATTTGGTAACCTGTTTTTTTTTAAAGATGGCGGCTTATGAATGA
TTATTTTTTTTGGTAACAGATCGTCCGGAGTGACAACCTGAAGCTATGGAAGCACTTGGAGCAGGCGAAGGACAAGCAGTTGGTCATGCAGGAGAAGATG
AAGAAGATCATGTGGATCCTGTTCCAGATCTACCGTGGAAAGCAACAGAACCTTCCCAAACTCTCCAGCAACGACGGAGGAGCTGTTGTCACCGAAGAGT
AAGTGTCGAAGAATTTGCGCTTTTCTACGGAGTCCTTGATGTGTGACTAACCAATTATGCTGCTGTGTGTTTTTTGCGATTCGTGCCTGCCTTTTGCTCG
CTTCGATTTTTGTAACTTGACGTATTGGTAGCTTCGGTAACAACAGTATGCTTGGACCGAAGGAATTCCGTGACGTGCTTCGATTCTTGGCCATGGACGA
ACCCCCGATGTTGCCCGGGTCAACCGCAGATGTCGCTACTGCCGCGCCTGGATCCAGAAAGCGGAAGTTTGTCGAGGTACCGTCCGATGTCAGTGAAATG
CTCACAAACGAAGGTCTTCCTTACAAGCTTGGTACGTTGGGCATGTGGATATTTACTTTTAAGCTCTTGATTTAACGTGTTTTCTGCGCCGCTAGAAGAG
CCGTCGTCTGTTGTTGAAGTCCCCAGCGCAGTGGAAGATCCCAACCCCTTTGCGATGACTGTGCCGTCGAACTTGGTGCACCCTGATGGTGGGCAGAACA
ATGTGCTCAGCATCTTTTCGCCGATCAATGCAGTGAATAACAGCGCTTCCAGCATGGATCAGACGCTAGCTGGATTCCTTACGAATGGTGTGGCCACGAC
TTCTGACGATTCTGCGCCGGCGACATCTCCGGTATCGTCCCCAACTGTATCACTGTCGACCGCACCCACACCGACTGTATCCACACCGATATTAAAACCG
AACGTGGGTACTCCGGCTGAAATAATTGGGAACCAGACACCGAGCAAGAGCACAAACGCTTCGAATGGTACTCCGGCTCAAGCGCCAGCAGACAACCAGC
TCGCATTTTTGGACGATGAGCTTCCCCTACTGCCCGATTCAGACCATTACAACTTCACTGACGGCGAGCAGGTACTGTAACACATCCTGTGTGTGCTTTT
CTTTCGTGGATAGTGGTTTAATGGCGTGTCTTTTGTTCGGCTGTGCATTAGCAGGCAGTAATGAAGAAACTTGAAGATTTTGAGACGTCGCTGCTTGACG
AATACGACGTCAGTTGCCTGGACACGCTGCTTCAGCAGCTGAAACACTCGAACGGGGACAAACCAGCGGGTGTTGCGGTGGCAGATCCGGAAGAGGTCGT
GGTTGGTCCAACCAACGCATCGACACACGATGCGTAATTCGGAAGACTACTACATCGAAGAAACTACATATCCACGTACATGTCAAGCGAGTTGTTGCAC
GGTTGCCTCCACCGATAGGACTCTTCTATCGATTGATAGGCGACGTGTGGCAACTTTTGTTTCGGGTATAGAAACAGATCGAGTGTCCAAAAGTCAAGCA
AGAAGAGAGCATGTGGCGCAATGGAGGCAGGGGCAGAGCAGCATCCAGATCGCAAAGCGAAACCAAGAGAGACGGAGACGAAGTTCGTACGAACAAACAG
CCAAGAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCCGAAACGATGACGACCTACATACACGCGGCTGTTTTTATTTATGCAGGAATGCG
AATTGAGACAACCAAACAAGAAAACAAGAAAAATGGTTCAGTAAATAGTCTTCTCGTTTTCGTGTTGTAAGACTCCTCCGTTTATCCTCTAGGTGCAACA
TCTCGGCCTTCCAATTGACTGCGCAGTCGTTGGATCTCCTTGTCCTTGCGCTTGAGCTCCAGTTGGGCTGTTGCGAAGAGAGTTGAGATGTTGGTCTCCA
ATTGTTTATTCGTAGCTCCAAGCTGCCGGTTCTGCTCCTGTAGCTGCGCCAGTTCATCTTTAAGCCGGTCATTCTCAGCCTCCACCTTGCTCTTAAGGTC
CAGCGCCTCCTTCTTCTCTAAGGCGCTGGTGGACGTGTCCAAGTCGCCATACAGGTCCTGGTCTTCCATGGTCTTAGTTAATGAACAAATCTTTTCGAAC
TTAAACGGAATCCCAGGAATTACTGCCATTCGCAACGATGGACTCGAGGTGCAACAAGTTCTGGGAAGATGGCCAGGCACTGGTGGCCGCTGTCTCCGGA
CCGGACAGCTCCGCAAGGATGGAAACGACTCAGGGAAAGATTTTCAAAGAACTGCGCACAATGAGTCGCTTGCTGCAGCGCAACCAGAGCCAGCGATTCA
GTGACGCGGCACAGCAGAAGCTCGTGGACTGCGTGGGGCACTACGTGGGACTGGGGAAGCAAGGAGGAGCGATGCTGCCAATAGCTGAAGCTACTTTTCA
AACGGTGAAAGACGGGCTTGCTATGCCTTTCAATGTGGTCGGCACCAAGCAGAAGAAGCGGTTGCTCAAGTGGTACAATGAGCTCATTGCAATTGTCGGC
GGAGATCCCGACGCGTCGATTGCTGGAGAGGTTGTCGCTGAGCCGAGTATTGAGTGGAGCGTCTTGGATATCGACGAGGACGGCTTCCTGTCGCTTATGC
AGGTGGAAACCGGTGAGACCAACGAAAGTTTTCAAGTCAAAAAGAAGAGCACAGAGCACAAACGCATCAAGAAAGCACTCGAGGACAGGGAGGTTACTGT
AGTTACCAGTGGAGATGATATTCAGGTGATCCGATTCGACAATGAGTAGATAGAAACCTTCCTCTGCATGATAGATCATAATTAAAAGGTGGCCAAAACG
CGTCGGTGGCTCATCTGGCAAACTCAGTTAGAAGGGACTGGCAGCATTCTTGTCGCGACTCTCAGTCCACGCCTTGGCGATTGTGCGCTTCATCTCGTCG
TCACCTTCAGCGTACATGTTCTACGGTGCGAATGCCACATTAGTTCTCAGAACTTCACAATACAGTCAAGGTTAAATGTCAACTTACCTTCATCATATCC
ATGATGCCCGCAGACGGGTCGCTCGTGTCGGGCTTAGTGCTCTTCAACGGATTCTTGGCCGTGAGGTTCATCCACGTGCTGTCCTTGTCCGCTTTGTAAA
GCGAAATCGTCACGCGGTTCTTTTTCACGCGGAACGAGCTCTTTGCCGGGTCGATCTCTTTCTCCAAGTGCTGCTTGAACAGTCTGAAAACACCAACAGT
CAATTAGAACGCAACTCGTAATTCTCATCAGCTATTTAACTCACCTGTAGTTCTTGTTATCCAGCCCAATAATCTACCACATCAACAACAAATATTTAGC
AATCATTTAACCTGATCAATACAGCAATACAGCAGTATACCTTCAGATCGAACGATGTCTTGGTAAAGTGGCAGGTCACGTTCTCCTTGGCCAAGTTACC
GACGCCATCGACGCCTGACATGATATAGACCGCCACCTTCTCCTTTCCATAGCCATCGTCCTCCCAGCCGAAGCGGCTGATCTCCGTAAACGTCAACCGG
TCGTTGGTCACAGGACGAGGCACCACCTTGGCCGGTTCCGGCTGGGGCGTATCCGCCACCTTTGACTTCTCCTGCTGCAGCTCAGAGGCCTCAAGAGCCT
TCTGCTTGCGCTGCAACAGCTGCTCCAGGTCATGGCGGTTTCCAGCCGTCTTGGTCTGCGCCAGGAGCGTCTGCATCTCGGCGATCTCAGCCCTCAAAGT
GTCGGTGCTTCCTGCCATTGCGATCCGGTCGTAAAATGATTAAAATGATGTGTTTCGTAAAACAAAATATATATTGTGATCTGGTGTCTGTTTCACAGTT
TTTTTTCTCATTAGACAATCGCGGGCAAACGATGGACGGAAGAGGTCCGACCTCGGTCGCTGCCGGAGCTTCTGAGAACACTCCAGCAGTAGCTCCTCCA
TCTATACGTGCAGGAGATCTCTCTGCTGCTTCCAGACCCTTAGACCACCTCGATGTGCTGTTCCCAACCACTGTACAGACCTCACAGGCCCAGTCCACGG
CGAATACGACTCCGAACGGGTCTCCAGCGATGCCACCGGCTCCAAATGACCATCACCAAGAGAACAGCTCAAGTAAATTACTAAGGACACCAGAAACAGC
CTCCTCTGATAAACCGGAGAGCGATGCACATCCAAATTCCGAAAAAGGCGCGAAACAGGACAACGGAGACCAAAATGGTCTGATGGTAGCTGGAAATACA
ACACACAGCGGCAATGCCGAGACTATACAACAACAGAAGGAACAGGTCGCTGGTGCTGCACAGGTCTCCGTTGAGAAGCAGAATGAGAAGGGGAAAATGT
GGTTCGAGGTGCTACCAGTGGTGCTGGAGAACTTCAAGGAGCGGGACCAAGAACAAATTAAGCGTACGCAAGTGTTGGAATGTTCCTTATTGGGTCGATG
GTGACTGACGAGAGTTTTATTCATTGAAACGGCAGAGTTAATGCTGCCACACTGCGAGCTATGCGAGCGAGGGATGGTCGCCAAGAAGGCGAAGGTCAAA
TGCTGCCAAGAAGGCTGCATTTTGAAGGAGCGAGCGCTGTGTGGTGCCTGCTGGCTGTCAACCCATTCGTCAGATGGCGCACGAAGACACCGTCGAATAT
CAGCTTCAAGTGAGTTTCGCTGGGAAATTTAAACCAAAGCGAGTCGGGATATCTAACGTGTTGATTTGTTCATGTCTGTTGCAGTTTGTCGGCAGTGCCA
ACGGAAGCCGATAGTGTATTGGTGTGCCGAGTGTGATCTCAAGTTTTGCAGCGAGTGCTTTGAACAAATCCACAGTGTTCCTAGGACAAGGAACCACCGC
AAGCTAGCGACAGAAGGTTTGTATATCCGTTTTGAGGAGTATCTTATTGCTTGCTCATTGTTTTTGATCTGTCATTGTCGATAGACACGCCTGGTACCTG
TCTGGTAAAGTCTCACTGGCCTGGAAGCATGGAAAAAGCGATATCTGAGATCATCCAGTCGCGGAAGAACTCACATCCTGCGACTAATGGCTCCTCCGGA
AGCTCAGGAAGCAACATTGGTGAAAAGCGGAAACGTGACGTTGAAGTGATTGTCATTGATGATGAGGAGAGTGATAACGAAGCAACCAATGACGCCCAAG
TAAATCGAACCAGTTCCATTGAGGTTTCTCAGCAACAAGACTATGGCGAATCGACGATAAACCAGCCCAACGGAACAGCAGCAGGAAGCGAGAGTGGAAA
TACTCGTCCTCGTGTATTGCTCCCTCAACTGCAGCAGCGTACTGCTGTTAGCGCGTACCCAAGTGCTCAACAGTCGATGCTAGAACCTATTGCGTTCCCA
CCGGGTTTGCTTCAAGCGACCTCAGTACCATTGGCCTCAGCAGCTCAGTTGGAAGCAGTCCAGTCCAGCTCAGCTTATGCCACTCCGTCATTGGAAAGTG
GGACCAATAGTGTCAACGTTACCTCGAGATTGGAGGCTTTGCCGTGGAATCAGTTTGGGGCTACATCATCGATTGGAGATGGAAGCAGTACCGATGCTTT
TGCGACGAGTGCCGTGACCAATGGGATGATGCAAACTTCGATACCAACCACTATGAGCACGACGGGCGGAATGTGGTCAACAACGTCTGCCATCAGCACA
GATTCGGCCAGCATATCCAACACCAGCAATCTCTTACCACTTGGAGGCGCAGTCTTTGCAGAGAATGCGTTGGTTGATTCATTAGTGGATCGCTACCATG
AAGTAAACCATAACGTGCTGAACCTGGAGTTGCAAACCGAGCAGTTGACCGGTCAAATTGCCGTTGCAACTTGCCAGGGACCGTACACTGCGGGCCCAAT
CATGGCCATGCTGAGCAAGGTGCAGACTGTTCTCGAGGAAGCAAGAAGGCGAAGGGACAAGATGCTCATTGCGATGATTATCCAGTCGAATGACATCATG
TCTGCTGTGCGTCTTCTACGTATTACGGAGCTCGGCGACGTGCCGCAAGTGCCTATAATAAGCCACCGCAAGTGTCTGCAGATATCGAACGAGATCAACC
AGCACAAGAAGGACCTCATGGATTTGAACCAGCAGTTGACTATGACGCTGACCCAGTCCCACGCAGTGAACTCCAGTTGGGAGAACGAGCTGATCCGGAC
GACAAGCGCCAACATCCAGATGCACCAGGAAAGTATCAAGAAGCTCAAGAAGGAACGCGAGGTGGAGATCGTTCGGATCGTGCAGTTCAGCCATTACATC
CGTCAGTTGCTGAAGCAAACGTTCCAACGAGCAGTAGAACTCCAGCGGCAGCAACAACAGCAATTTCAGCAGTATGGATAGAGTGACCAAGAGCAGCACA
CAGTGTAGGCAAAGTGATTATTTAACGAGGCGGTTTGAGCTGCTGTGTCACCCGTGTCGATACACAAGGAAGCCAATCTGACCCAGGAAGAAGTACAGCA
TTCTGGCACACAAGAAAATGAGGTAAGAAAGCGTATCGAAGGTATTTCAAAGTGTCGCTGTGTCTTACTTTTTGACTTCGTGCGAGACAAACGACCCGAA
GGATTTGCCTACGATGACGTGCCACGCGCCTTCCTGAGTCTCCTCAATCTCGTGCTTAATCTGCTGCGCAACCTCTGTGAAGTGGTTCTTCTCGCCCTTG
TACAGCGCTTTGAGTGCGTTGGTGGCACTGCTGAGGATCAGCTCCTCGAGCTCCTTGGACGTGTCTTGGTACACGATTCGCAGGCCTCCGACAGCCACGT
CGTCTTTCTTTTGAGCCTTGGACATTTGAATCTGTTGCGGATCTTTCACTGTTGGGACGACTTTACCGACGGTTAGATCTATATCCAGAAGCACGAGACC
GATACCAAGGAACATGTCGAAGAGCATTTACGAGCAATTAGTTCTTCAAACTGTGCGTGGCGTGTTGTTCCGTGAAGATACAAAAGTCTTTGGCACAGAG
GCAAAGGAGAAAACTGCTTTAGGAATCCCGAAAGACTCGCTGCTTCATTTCCTGATCAGTTCCGGTAACCAGAGCTCGGAAGAACCCGCTCTAGACGAGG
ACAACAATGGTGATAAAGCTGAAGGTTCGTGGGTAATGGATTGTGCTACTTGGTCGGTTGAGCAGCTCCGGCGCGAGAAAACTACCATCAAGTGCTACCT
CAACGCCCAACGCCAAAAACATCCTCACAACTACCGAAAAACACTCGGTAACAACTTGCTCCTGTTTGAAGCTTACGCGTTGATCAAGTTGTTTCTTCTG
GAGAGGGACCTCGACTACCGGCAGTGTCTGCAGCAGTCTATCGGCTGTGATGACTCCTTTGTGACGCTGATACAGGTGCTGCTCACGCTCTACGCGAGAT
ACTTCGAACGCGTCCACGGAAGACAGGTACTATCTGTACTTTTCAGCTTGTTATCCACGTTACAACTGAACTCTCTATGCTCCAGATCTCGGAGAAGACC
GATATCAAGCCGATCGAGACGCTCTATGACTTTTTCCTCACTCACCATGACTAGTGAAGCTCAGTTGATGAAGTAGCTAGCATCCACCTTCCGTAGTACA
TGAACTCTACACGAACGAGCTGTGCGTTGGGATAATGTCGTCCTTCTTGGAATCCATGCAGGGCACCGACAGCCACGCGTAGTAGAACGCAGCGCCGCCC
ATCATGTGCATCAAGCCCTTGGCGAATCCGATTGCTGTGTTGTTCTCGTCCTCCTCGAAGAAAATCGCGATAAACCCGACGATAGTCGCGACACCGAGGC
AACCGATAGCGTACGTAGCGTTCTGTTTGCTCAGTGGGGAAATTTCATTTGTCGGAGTGAAGACACGACGGTAGACGACGCCGAGCAGGTAACAGACGAC
CAGCAGCCCCTCGTAGAGCGTGGAGTCCCATCCGTCCTTGGTTTTGAAGAGCCAAGCGCCCGCAAAGGCCGCATAACGCAGCACAATGTTGTGGTTCTCG
TCCTTGTAGCCCATGAGATGCACGCAGAGCAGCAGGAAGTACGAGATGGATAAAACGTCCGAGATAAAGTGCCACTCGTCCTCTTTAAGGAACAGCTGCG
TGTCGAAAGCCTCCGCGGCGTTGAAGCTGAAGGCCACCACGAGCTGCAACACGCCCACAAACAGCTCGAAATGGCGGCGATTGCGCTTCATGACGTCCAG
CGCCGGCAGCATCGCGGCGTCCGTCAGCGCCAGGAACACGAAGCGTCCGATCTCCAGCAGCATCTTCTATTGCGATCGTCCTGCAATTGTCTGACTACCC
CCCTTGGACATTCAACCAATCATATTTCATATTGAATTTAGGATTCAACCAATCAGAAAACTGTTCAACGTACGTGAATGCGAATCCGGTAGTCGAGCAA
CTCACTTTGCAATTTGCGCAACACCGGACAAGCCCTCAAGACCGAAGAATTGACGATGCCAGCGACCGCTACGACGCCTTTAATACTGGACGGTAAGGCC
ACGAGCGACGCGATCCGCACGCAGCAGTTGCAGCCTCAATGTGCCGCCTTTAAAGAGCGCTACGGCCGCCCAGTGGGCTTGGCCGTCGTCGTCGTGGGCT
CCCGCAAAGACTCGGCCACGTACGTGCGCATGAAGCAGAAGGCGTGTTCGGCTGCGGGTATTGAGTCCTGGAAGATCCAACTGTTATGGGATGAGAACGG
CGACGAGGAGAAGGTGACGAAAGAGCTGCTAGCTACGATCAAGCAGCTCAATGAACGGGAAGACGTGGACGGCATCATTGTGCAGCTCCCACTGCCGTCT
TTCTGCGACGAAGACGCGATTCTTGCCACGATTGACCCGAAGAAGGACGTAGACGGGTTGCACCCCGAGAACCACGCTAAGCTCTTCCAGTTCGCGACCA
AGAAGGCGACCTCGCAACACGAAGAAGCGCCGTTCGCGCTTCCCTGCACACCTGCCGGTTGTCTTGCGCTACTGGATCACTACGACATCCCGTTGGAGGG
GAAACATGTTGTGGTGCTTGGACGCAGCCAGATCGTTGGTCTGCCCGTGTCGTTGCTGTGTCTGCATCGCAACGCCACGGTCACCATGTGCCATTCACGT
ACTAAAGACCTCAAGGCGCGTGTGCTTGAGGCCGACATCGTCATTGCAGCCATTGGACGTGCGCGCTTCGTGCAAGGAGACTGGCTCAAGGCCGGTGCGA
CGGTCATTGATGTCGGGATTAACCCAGTGGAGGACGCTACGAAGAAGAGCAGGTACCGTCTAGTTGGTGATGTGGATTTCGAGGCGGCTGTGAAGGTTGT
GCACGCCATTACGCCGGTGCCGGGCGGTGTGGGTCCAATGACTGTGGCTATGCTACTGAAGAATACCATTCAGTGTGCCACGCGACGTGTGCAAGAGTAA
ACGAATAGGAAGTTCTTTCAGCTGTTTGGAGAATCACCCGGGCCCAGCTGACGCACTTAGCGACTTGCCCGGCATCGGCTGCTTCTCCTAGTTTGGTAAG
GCGACACTATAAGTACAGCGTTCCCTGACCTCTATGCTTCGTATTATTTCCAGTTAAAAGCCTGGATCATCAGTGCCAAAGAGCAGATCTTCCTCGTCTT
CAGACGAGAACTGTCCGCTCTCTTCCACGAGCTGCACGTCTTGATGCAGTTCCTCCCAGTAGCCTCCGTGTGATTGCTCAGCTGCGGCCGCTTCGTGCTC
CTTGGGATTGAGTTCGGCGTCCTGGTCGCCACGAATTGAGTGGGCTGACGCTTGTTTCTGGTGAAGATGGTCCACTGCTTCCGCCAGTCTCTGCAGTGCC
GTCTTCTCGCTAGCTGGGCGGTTCAGTGCTGGTTGCTGGTCTCTTGGTTCAGCTTGTGACGCTCCGAAACGCCGTTGAGCTTGCAGAAGAAGCCGCATGC
AGTCCAGTTGACCGTAGGCCGCAGCGATCTGTGCTGGGTTCTCCCAGTCGCTATTACGTAGTGTTAAGTCTGCTCCAAGCTGCAAGAGGTTTTGCATGAC
GGCTGCGCGACCTGAGAACGCTGTCCAATGCAACGGAGTGTCACCTCGTTCGTCTGCTACGTTCAAGTTTGCTCCATATTGAACCAGCCGAGAAATGATC
GAGAGCGCAGCAGGAGATTCCACTGCGTAGTGCAATGGAGACCTGTGTAGATCGTCGAAGGCATTGACGTCGGAGCCTCCTCCTGGGGTCAAAAGGTAAG
CTGTCATGGCTACGTCATGCGCAAGAACAGCAAAATGCAGCGCTGTTCGACCGTCGGAATCTCCTTGCGCTTGGAGATTGCGATTCCACTCGAAATTCGT
CTCAGTCGGGACCACCAGCTGCTTGGCACACTCGATAAACCCCTTTTCAGCCAGATAATGCAGCGGATATCGGCCTCCTCTATCTGGTGTGTGGAGTGAA
AATGCCGCTGGTATGAGGGACGAGATAGTTTCAACTGGAATAACGATCTCTGCGATCGAATCTTTCATCATCAACTGCTGCAGAAAGCCGCATATCTCCA
CTTGGTCTGCCTCACAAGCTCGATGCAGTACGTTCTGGCCTCTACTGTTGGTCAATTGGAGATCAGCTCCATGTTGCAGCAGCTTCTTTATGAATTCGAG
GTGACCAAGTGACGCATATAACATCGCTGGTGTATTACCATTGCAGTCGACAGCATTCACGTTCAAGTTGGCTCCGCAAACCAGTAAAAACTCCAGCATT
TCAGCGCGAGATCTGTAATTTTCTTTGGAAAACGACAGCATGTGAAGTGCATTTCGCTGAGTCTTGGCCTCAAGAGCTCCCAGATCACACCCTCGTTGCT
GAAGGAAAGTAGCGTCTTCAACTGATGCCGTTTCTACTGCCGTAAATATCGTCATTTCCTTCTTTACTCGATGTGATGGAGATGACGGTGAGGACTTTCC
AATTGGAGACGACGGTAATGACACGGGCAACGGTGCAGAAGCCACTTCGGCGCTTGTATCGACCTCTAAGAGCACCTGACGGTTAAGATAAGCGCGATGC
TTTTCCATTTGACGCAGTAGCTTGACAGATAGAGGTAGCTCCATTTCCTCCACATCGTGATAGCGGAGTTCAGGCATCGGGTTCTCATTATCTTCCACGC
AAGCTAGAGAGTGTAAAATTGGAAACACATCCGCCGCAATCTCTTGCAGAACTTGATTACTCTCAGACTCCGTGTACTCTTCACTTGGTTCGAACACTTG
CAGTAGTTTACGAGTCATTTGCGAGTCCAAACGAAATCGGAGCAAGCGGGCGTTCCGGTTCGTTTGGGTCGACTCGGACTTGTCCCAATCCAACCAGGCA
CGAGCTCTCTTGAAGTAGAAATTGAAGTGCTCCGTACTAACACTTTCACTTGTTGAGGTGTTAAAGGAGCGTTGAAAGTAGAAAATCATCTGCCGACGTC
TTATATAGCTCCGAATACACTTTTGAATCACACTTGCTGCTTCATGGCAGAACAGGATCTGGTTCACACTGCGCGACAGAATATGCGGCAGCTGTCGATG
TCCCCAATCTTCCACTGTCATCTCCACCGTAGCTCGCATCAACACTTCCTCTGGCTTCGGTTCTTGGATGTTTGGTGTAGATTCTTCATTCTGAGGTTGT
TCGACGTGCTCTTCTTCATCCACTTTACCTATAGACCCGATATTATCCACTGATGCAGTCGAAACAACTTCCCTGTGGGAAACACCTTTTGTAGCAATCA
GACTCCTCCGAGAAGCCAAAGCACGTTGAATTCGCTTTGCAGCCAACGTACGTTTGGCCGCAAGTAGCTTCTTTTCAAGCGCTCTCGCCTCTTGGATCAA
ACGCAACTCTTCACTTTTTACAATTGCTCGCTTAGCTTGCCGAATACCCACTTGCCATTGACGCCAGCAAATCTGCACTTTCGTTGCGAGTACCGATATC
AACAGACGATATTGTCGAGCTTCCTCGTCGTGTTTCATCTCCAGCGCTTCCAGGTACTGCATTCGGTACAGTTTCCCCTTCCAGATGGCTTCAATTTTCG
TAGCTGCACTCTGCTCCCGCTGGTTTTGATGGTATCTCTTAACTGTACGTGCGACGCACCGACCATAAGAACGACGTGTGATAACCTCCAGCTTTTCAGC
TCGTTCAAGTTGTTCTGGGTCTGTAGTGGTAGAGCTGACAATGTTGCTATCCGTTCGCTGTTCAAGACGGAGATTCCGCCACCTCCTCCAGTGCTTTTGT
ATCTTAAGAGCGCTGATGTTTTGTCTGTGACGCAGACGTTCTTGGGAAAGTCTTCTTCGTTGTTGAGACATCCCCCAGTTCCGTTCAATCTTAAAGGAAC
TTTCGTCCTGCTCCTGTTGAATGCGCTCACGTTCAAGTTCTTCTTGTTGTTCGTGCTGCCACTTGAGCCACAGCGTTTGGATCTTTAACGCAGCCATGTG
CTGTAGATGTTGAACACGCTGCCGCTCCATTTTATGTCGGTGTTGTCGAATCCCCCAATTCCGCTGGATCTTCAAAGAGCTCGCATTTTGAGTCTCCCTC
GCTTGCTGTTCTTCACGTTCCTTTTGGTGGGATCGTTCTTCTTCTCGTTGACAATTATCTCCAGCATTTTCTTGGAGATTCTCCTCATTTCTCAGTCTTC
GAATTGAAGCACGGTGCGTTTGCCATAGCTCTTGGATTTTAGACGCATACGCATGCTGTTGTAGTAAATACCCTGCTGCCTTGAGCTGTTCGATCTTTCG
CCACTGTTTTTGGATCACCAACGCAGCTTTATTCCTACGCTCGTGCTCCTGCTTCAATAGGCTCTGTTTTTCGTTCTCAAGTTGCGTACTTCGTTGATCT
TCCAGAACTCGCTTGCGTTCAGCTTGCTCCTTGTTCCGTCTAAACAGCTTCCCAGTCCAATTCTGCTGGATTTTCAGTGCGACTTGGCGCTCCTCTTCAC
GTTCACGTTCAATTTTCTCGAGGGATTTCCTGTGCCATCGTCTCCACAGTCTTTGGATTTGCTCGACAGCACGAATCTCTCGCAACTTCTTCTTCTGCCA
CTTCTCCCAGCGTCTTTGTATTCGAACGGCACTTGCCTCTCGCCTCCGTCTCCAGCTTCGCCACTGCCGCCAGCGCTTCTGTAGTCTCCTAGCAAAAACA
TCTCGTTGAATTCGAATACTTCGCCTTTCTCGCTTAGCTCGGTGCCATCGATGCCAGCTCCTCCACTTCCTCTGGATCACTTGAGCGCAAGCATTCTGCA
TGATCCGGTTTCGTGTATTCTTCACTCGCTGTTTCTTCCGCCACGTCCTCCACCATCTCTGAATGCGAAGCGTGTGGGAGAAAACTAATCGATGAACATG
CCGTCGATCTTGAATTCGTTTGGTCCGCCGTCTCCAAGCTCCTTGAATCTTACGCACATTAGCTCGGTCTCGAATCGATTGAATCCGCTGATTAAACGCA
AGCTGTTGCTGCTGTCTCCGTTCACACTCGGCCTTGATCCAACGTCTCCAAACTCGCTGGATCTTACGTACCATAGTCCGCATACGGATAACCTTTAGCT
GCGCTTCAAACGCCAAGCGCTGGACGTGCCTTCGTGCCCGCTCGCCTTGGGTCCACCGTCTCCACACACGTTGAATTTTACGGACATTGGCTCTCAAACG
TATTTCTCCAAGACGCTTCGTGAAAGCAAGTTGCTGCTCAATTCTTCGCTCTCGTTCACGTGAACTCCAACGTCTCCAAACCCTTTGAATCCTGTACACA
TTTGCTCGAGCGCGTATCACTTCCAGCCGTGCATCAATCATCAACTGCTGTTGAATTCTTCGTTCTCTTTCGACCCATCGCCTCCACACCCCTTGGATTT
TGCGTACATTTGCTCGGACTCGTACTTGTTCAAGTTGTGCTTCGAACGCGAGCTGTTGCTGCCTCCTTCGATCACTCTCACGTTTGGTCCAGCGTCTCCA
TATGCCTTGAATTTTACGCACGTTCGCACGAATTCGTATCGTATCCAGGTACGTCTCAAATGCGAGTCGTTGTCGATGTCTACGCTTTTGCTGACACTGC
ACCCACCGTCTCCAAACACCTTGGATTTTACGCGCGTTAGCTCTCCGTCGTATCGCTTCCACGTGCTCGTCAAAGATACGCTTCTGCTCTCGTCGGCTTC
GCTGCTCTTGAGCCCACTTCCTCCACCACGCTTGAGCTCTTCGAGCTGAGGCTTGTTGTTGCTTATTTTCTTCCAGCTTAATAAGTGCCACCTGCTGTGC
GTTCTCCACTCTCTTCATATGAATCCATCGACGGCAAGCTCGCTGAATCTTCCGAGCGCAATTCATCCTCCGCAAGAGCTTCAGTCTCGCAAATTTGTGC
AGCTGAGCTTTGTAGAGCTGTGCCACACCTACAAGACCCTGACTGATACCTTTGGTACTCTCTAGCTCAGTCAGTAGCTTGACGTCAAGGACAAGCTGCA
CTAACTGAGCCCGGGTACGAGCTGCAATCGCCTTCTCCTGCGCAGATTTCTGCTGGTGTTGTACCCGGATTGTCTCCACCGTCTTCTGGCTGCGATGCTG
ACTAGTGCGTTGGTGGAGTAAGTTGGAGGCCTTTATAGAGGCAATTTCTCGTATCTTAGCCTCATTGGAGCTTCGATGCTTCTGCTTTTCCTCCTCCAAC
TCAAGCGCTGCCAATGCAGTGATAGCAGCTTGTTCCTTCTTGAGCCTTGAAAGCTGAATTTGTGCTGAAACCCACGACGTTATCTGGTGCATGCTGGCTT
CGACTCGACTGTGCTCCAGAGCCTCTGCTGCTTGTCGCCTCTCCTCATCTTTTTCCAGCGCTAATTGAATCTTAGCTGTCCGTAAGTCTTCAGATCGTGC
TTCCACATCGTACAGGCGCTGCTGAAGGTCAAAAGCGGTTGATAACGCTGCTAGACGTTGGTCCCGTTGCTCTTCATTAGACATGAGTTCGATTTCAGTC
TTCTCTGCTTGCAGACGCGCTTGTTCCAACACCAACCGTCGTCGCTCCGTGTCTGCTCTTCTGTTTAGCGTCCTGGCATCAATAAAAGCTGTGATCTTCT
GTCGTGCATAGCGTTCTTGGCCAATTCTTTCTCTTGTTAGATGCACTTGAATCACTTCACGGTGCGCAGCATCAGTTTTCACAGCTTCTTGTGCGAGGCG
ATCAAGTTTTCTCTCCATAACTCGCGTCTGTGTACGGGCCTGGCTAATACGTTTTTGGGTCTCAAAGTCTCGATGTTGCTTCGTAAGCAGCTCTTCTTGA
AGTCTGACCTGATACTGCTGCTTCTGCAATTCAGCTCTGTGCAGCTTCTTGTGAAGGTGACACACTCTGAAAAACATTTGGAGCTTCAGCGCCGCCAATC
TACGTCGCCGTACCTCCACTGCCTGCTGCTGCTGTTGAACTACGCGATCATGGTGCGATAACAGTCGCAGCCGTTCGTCTTCTGCAGTTTTCCACTTCCT
ATCGAGATCTGCTAATCTCATGTCCATGTCGGCAATCAGCTCCTTTTTATGCTTTGAATTCAGCTTCATACTCCTCTCCACGTCTCGTTTGGCCTTGGTC
CACTTCAACTGCTCCTTGAATAAAATGTTCTTCGCCATCTCCTGAGCAGCTTTTAGTTTACGTCGAAGTAAAATTTCTTTCAAGAACTTTTGGATTTCCC
TCAGAGCTCGAGCTCTTCGCTCGCGTTCTCGAGAAAGTTTGTCCAGCTGCTGCTTCTTTTTCTTGAGACGAGATCGCTGTTGTCTCCACCACCGCACAAC
CTTTTCCTTCGCGTATTCACGTCGACGTCTTCGTTTCGAAATACCCACGTAGAACTTTGCCCGGTAAAACGCCATGTGAATAACACGGAAAGTGTCTTTT
TGTGCGGAAACTCGTTTGTTGTGCCGGTAAATCCTCCAGTTCCGTTGTATTTGGGACGCTGCGTGGAATCGGCGGTCATTTTCTTCCTTTATCCGGGCTT
GGAGACGCCGCCAGTGATGAAAATTCACGAATTGTCGGACCTTTCGCCTTGCCACTAATCTGCGGACGACCACCTTCGCTCGTTTATGATCCACGACCGA
GACCTTCCACCACGCGAAATTCCGACGCAACATCTTCAACTCGCGCTCCAGATACTTTGGGGCATTGTTGGTCTTCACTGGGGAAGCGTGACCCATCAGG
GACAAATAAGGCTGAGCAAACGACTGAATCTGGTCCTCGACTTCTCTCTGGGAAACCCAATGGCTCATGCCAAATGCAGTCCCTTGAATATCTCGACAGA
GCTCGAAGATCTTCTTAAATTCGGACTGTTCACTTTCATTGCCCCCTTGGCAGCTCGTAGCTGCAAAGATGGCGCTAAGGGATGAAGCAGGAACTGAACG
GTCCATTTCTCGGTTGAATAAGACAGGAATTTCGCAAAGTAAAGCTTGGTCACAGTTTGCCACCGAAACACTGCTACGACCAGAAACTGGAGACAAATCC
ACCGATCTTGAACTGGTCAGGGAGGGGTCAAAGTACGGCGGTACGGGAAATACCTGCTGGTCTGTCATGTTCACTGAAACAATGCTGCGTCTTGATACTG
GTGCTCCATAATCTAATGCCTCCTCCATGAATACTTCGCCAGCTTCAGCGCTCGAAGGTTCTTCCAGACGAGAGATTATAGATCGGTAGGTACTGATTCT
AGAAGAACTCACATCCAGAGGAATTTCCAGCTCATGTTCACTTTCCACTTCAGGAGCAGAGAAAATGTCTTCTCTCGACACGCCAGGTAACAGACTTAGA
GCCATAGCAATGTTCGAGATAGCTGAACTCGAGGAGTAGGCGAATTCATCTTCTAGCGGAGGGATTTCTCCTCTTTGTTCGATGCTTTCTAGTTCCATCG
ACACACCATCCTCCAACAGCATTTGCATAGGAGATACTTGAACATTATCGGTAAGATCCATCAGAAGTTCTTGCGTCCTGGTCGACACGAGACTCGCAAC
TTCAACGGGAGGGGTGGTTTCCTCCGGCTTCAAAACCTCACCAGCTAAAGCAGACTCTGGGGTCGACAGCGTAAAATTGGGAAGCATTTGCAAGGCCATG
GCGATACTGGACAACGCATCATTGGACGAGTACTCAAAGTCACAGTCATACGTATCCTCGTTGCCTTGGTCGGCCTCCCCACGATTTTCTGTAGGAATAA
TAACCTGGTTCGCTGTTGTTGGAGCACCCACAGCGCAATTATCTCCTTCCATTACAGTACGAGACAGAACCAACGGTTCTACCAGGGATGGCACGATAAA
AGCTGGTTCTGTACCGTTCAAGACAAGAAGATCATCAGACCTTACAGACGACAGATGCTCAACCAGCTCTAGAGGCTCAGAGACGTCTATCTCCGGCACC
AACGTTGGAGATCTTGGAGAAACACCCGTTGCATCGAGGCCAGGTTGAGACAACGAGACAGACAGGCTTCTGGCAGTATCATCACGCACTTGGGTCCCTT
CATCATGCTTTGATCGAGCAGAAATACTTCTCGTTGACCTGTACGTTGTTTGTGTAGCAGTTGCTGTACTCAGCTGGCTTACGTGAATTCCACAAGGCAT
ATCTTCCTCAGAGTCCTCGTTGCGAACTTGAATCTCTTCGGCGTACAATGATCGTATTGAAGTGCTTGTCATCGACCTGTGCGTTGTCTGCGTTAGACCC
ACTGTAGCTGTATTTCGTTGGGTCATTTGGATCCCAACATCTTTTGAAGTATTCCGCACACTCATTTGGACCCCAACATCGATAACCTGGTTGTGTTTCA
CCTTCGCACTTCTGTTCTTCTTTCCCGATGCAGATCGTTCGGAAGAGTTGCCTCTGCTAGATGATTTCGCTGCTGCCGTCAAGTCGCCCATAGCTACAGG
CAGCTCCAGTTGCGTGGGTTCTTCATTCCCAACATCAGCCCCAGGCATCTTTCTTTGCGTCGAAGGTAGGGATGCACCAGAAGGTTCCAAAGACGTATTC
GCTCGTACAGATGCAAGATCGGTTGGACTTGTCGGTGGCACCCACGCCAGCGACGGTAACGATGGTTTCCCAGCTTCATCTTGTGATGATAGCCCTCTAG
CTTCTCTGGATACACTTGATAACCTTCGAGCGCAGTCATCCGAAGTATGAGCCAGCGATGGTTGACTAGATGCAGCAGCCACCAAAGCTCTGGAAGATGC
CGACTTAACGTCCACTGGGGATCTCACTGTTGGAGAGCCAGCCCACGCTTGCATCACAGAGATGTCACTTCGCTGATCAGAGTGAGATACTTGTGGGTCC
TGGCGATCCAATCTTTGCATAATTTCGCCCCCAAAAGTGTTGTATTCACCTTCCAGTTCATGGCGTTGCTGAATCGGTCGATTCAAGTGGCTCCTGTAGC
CACTGTGCGACTGAAGATATCTTGGCAGCATTTGTACAGCATTGAAACGAGTCTCAAGATCCATGAGATGCAGTAAAGCCGCTGCCACACGTTCTGCAGG
TAAAATTTGCCATCCCGGGAGATATCGCTGCGTTTGAAGTGAAAAAGTCTCCAGTTTATGCGTCAACAATCGCAAAAGCGAAGACGATGACGACGACGCA
GAACCAAATAAAACATCGGACGATGCGTTTTGGTGACACGAACATAGCAGAACCTCCGACGAGTCCAACGATAATCCATCCACGAAAGGGTTACGGGTCA
AGTTCACTTCAAAGTCCTCAAAGAATCGTTGTAGTGGTGGTGAACATGCAAGGAAATCTGTATCGGACGAAGCCATTTGCAGTAGGTATCCGTAAAAATC
CCGCTCCAGAATGTCGTGCTCGACACTCGCGCCAATCATGTTAGCTCCAAGCTCATTGCTCAGATACACCACGGCTTCCACCACTGCGAGCGACAGACTG
CGCATCCTGTTGAGCAGTTTTACCACTCGTTGTGGCACGTTCTTCTCCACATGAGACGCCCGGTGCAGTGGCAGTACCCCCATGAGCTCCTGCTGCAAAT
GAGCCATGACTTGGTCCCGTAAGTGTATGTTTAGCTGGACGGATTCGATCACAAGGCCAGCAGGTGTCTTCTGTAACGATGATGAGCGTGTCACCTGCTG
CAGTGAACCCGCGCTGGAGCTGTGCGGAGAGTGGTGATGATGGCGTAGGGATGTCGGGTCGTGTCGCGTGCCTAAGACTTCCTGCTTCAACTTGTATGGG
ATCGAAAGGCGCCTGGCGTGAAGCTGCTGCATCTGGCGCTCCGTACGTGGCTTGGCCGCTGTATCTCGAGGGTGTCTTGATGGCAATGACTGCTTTGGTT
CAGCAGCGTAACGTTGCCCATTGCTACGATGCCGACTATGACGTGCGTCACCAGCGTAGGTTGATCTCCTTTCATCTGGGTACAATGCGCTGTTCTCCAT
ACCCAGTCGCTGGGAGTTTTGGTACAGCGAGTCGTCCAGCTCCAGTTCCACTAGAAGACGTTGTTGGTCATGGCGTCGACGTCCTCCGAGCTCCGTAGCT
CGGCGCATTGTACAGCTCCCAGTGGAAGTTCCACCGCCCCACAGGAAAGTTCGATCAGCCATACCCTTAAAATAAGTCGACACTTGCCAAATGCTCGTTC
TAGCTTGACTCCCACCGTCGCCTGGGACGTTGCTTGAATGCGTTTCGCTAGAAAATCTGCTCCTAAACAGACAAAAAATAAACAAGAATGCAGCTCTGGT
GCTAGAGTAGATGAGTCTCTTTAAGATTTCCAGTGGTAATCGCAATTACTCCATTTGTACCTAGATCAGCATGTCGTCATCCTCTTCCTCGTCGCCGTTG
GTTACCGTGGAGAGGCCCTGTGCTCGATACAGATCGGCGATCTGTGGTCATCAAGAAATATCACATTAGTGAACCAGTATTTTGCCAGATAAGTAGTGCA
ATATCAGTTCATTCGTACCTGAGCAGAGTTTGTCGCCTGCGTCGTCTCCTTATCGTCACGGATGCGAATGAATCGAGGGAAACGGAGCGAAATGCCCTTG
TCCTTGGCCACAAGGCCGATGGCTGCTGTGTACTTCGGCGAGATCGAAAGGTCAGCGCCTAGAATCTCCCACACACAGCTCGCCTCAAACCAAACGTCGG
GCTTGATTCCTTCGCCGACAGCATAGTCACTTGGCGGTTTGTCTACGACCTTCTCCTTGAGCTGGTCGTAGAATTGCTTCAGCACTTCATCGGACAAACC
AGTACCGAGCTTCGTAATGGGTTGGTACATCTCCGTGTCCGGGTCGTAACATGCCAGCAAATAGGCCCCATACACACCGGTGCGCTTACCGCGGCCGTGG
AATGCGCCGATCGGAACCAGGTCTGCAGAATCTCCAATACCGTCCAGGTAATCCTTCTTCAGCTTCAGCCACTTGTGGGATCGGTTGGCTGGCTCATATG
TCGCCTCCTTTTCGAGAGTTTTCACCATCAAACCTTCACAGTTTTCGCGTACGGCCTCTTCGAGGAAATTGCGAACCTTGTCCACAGCTTCTTCCATAGC
CTCAGGGTTGTCCTTCACATCAACACCATCCTCAACATCCAACGCTGTAGCGAACTCGAAGTTTCCGGGCTTCACTTCGAACATCTCGCGCAGTTTTTCA
CGGCGCTTGGCTAGTGAAGTGCTGAGGAATGACTCACCGTTAAGGAATAGCAGATCAAATGCATAGATACATACAAGAACCTTGATATCTTCCACTTTCA
CATTCTGCAATCACCACAAACACAGTGACAGGTTAGCACTTAGGCCGAATAACCTCAAGTCTTCTTGCAAGTACCTTTCGAGAGCGCGTGCTCAGAATCT
GGAAAGGCAGGCGCTTGTTAGTCGCACGATCAACAGCAACCACCTCCGCATCAACGATACAGCTCTTGACAACGCCCTTCTTGGCAGCTTCCGAGATGGC
CAGCTTGACGTCGGGGAATCGCTCAGTAGAGTTCTCGAAATTGCGAGAGAAAATAGCAATTTCTCCGTTTGGAAGAATATGGATCTGAGCGCGTTCGCCA
TCGTACTTGTACTCGCACGTGAACGGCTTGCCTTCGAAGCGGTCGAACACCATCGCGTACGCCTTCGTCGGGCGAGCGAGCATAGGAGACACTGGTGTGC
CAGGTGTCAGCACGCACTTCTCAGCAACCTTCGCGAAATCCTTCACACGGAGGAAAGGAGCACTTGGAACCTCCTTCTGGACTTCATAAAATGCTGCTAT
GAGCGCGTTGTAGCTGGGGCATTCAGCAAACGCCTTCTTGACAAAGGCAAGCGCCTCCTGCTGTTTGTCTTTGTCCTTGTATTCCTTGTCCGTCATAAAC
GCGTAGGTCAATCCCATCAGGATCGACTTTTCGGCCAGCCCAATTCGAAGCTTACCTTGAAGCCCGCGAATAATATACTTGGCTCCTTCAGCAGACTGAG
CACCTTTGTCTTTCTTTTCCTTCTCGCACTTCACCAGCAAACCCTTGATGATGGAGCACTTCTGCTGCTGCGAGTTGTTTCCGGTCATCTTGGCAATCTT
AACGAACTGGTTGTACACATGCTGCACGGTGAGTCCACTGCCCTTAGAGGTCACAGGTTTGAGAGACGCGAACGAAAGCGTCTTTTGTTTTGATCGGGCG
TTCTGCGCAACCTTGCCGAGATCACCTTCCTTGTGGTACATCTCCTTGATGAACTTAAGGTTTGCTCCTGTTGCCTCACCGATGGCTTTCATCAGAATAG
CGTCACCAATACCAATTTTCAGGTTCTCGAACGGCGGAGCGAGGTCAACACACACACAGAGGTAGATGCAGGCCAGCAGATCGTCCGGTGAACGACGAAT
GACATCGCGAAAGAAAGCCGTCAGCAAGTCCTGAATTACGAGACGGCCAGTAACCTCTTCGATTTTGGCGAATAAATGAGCCAGATCAAAATACGGGATT
TCCTTTGGTTCATTGCCATCCTCCTGCTTCTCCGCCGCTTGTTTCGACTCCGACTCATTTTTCGTCTTGACTGTCTTCTTCTCGTCGGCTTGGGTTGGCT
TAGTCTTGTTCTTCTTGCTCGAGACTGGAGAGAAGAAGCCCGTCTTCGATCCAGCAGGAGTCGCAGTCTCCTTCTCCGTCTTCTTAACCTCCGTCTTCGT
CTTAATCTCCTTCTTCGCCTCCGTCTTAACATCCTCCTTAGCCTGCATCTTACCCTTTTTGGGCTTAACTTCTTCAACGTCTTCAATCCTCTCCTCTTCA
GATTCTTCCTTCTCCTTCTTTGGGCTAGAAGTTGTCTTCGCCTGTTTCTTGGGGCTCTTGGCCACCTTCATCGGCGCTGCAGTCTTCTTCTTGGGGCTCT
TGACCTTCTCAGGAGTTGACGTTGGAGATGTCATGTCAATCATCTCCTTTTTCTTGCTCATGGGAAGATCCAGATCGCTGTCCTCGTCGTCCTCTTCCAC
GACGCGTTGGCGCAGTCGACGACGGCCAGCTGCACAGGACACACAGTATTATCAGCTATCGTTGCATCAACTAGTAATATGATGACCAATTCACTAAGGC
AAACGTACGCTTCGTCCTGCTCTTGACATCTTCTTCTTCCTCTTCCATTTCAACATCCTCTGGCTCCTCCTCCACCTGCTCCTCCTCCACCTGTTCCTCC
GTATCCTCTTCAATATCCTTCTCTTCTTTCTCCACTTCAGTTTTCTCCTCTTCCACTTCCTCAACCTCCTCTACTTTTTCCTCCACTTTGGCCTTCTTCA
CAAGCTCCTTAGCTTCCTTGTCATTTTCTGCAGGTTTCCGCTTCTTGGGCGGCTTCGTGCTGAAGAACGACCTGGCCAGCAGAAAGAACGTTAAACACAG
ACGCAGCTACGCGTACACAGGAGAAAGAGACTGGACATACTCGATGGTGCTCTGCTTGGGCGCCGCTTTCCTCCCCATGGCCACCAACCTGCAACCGATC
AAGTAAATTCACAATTGGAGTAAAAAAGATTGGCGCCAAAACAGTTTTATTTATTACCCACAATTTTGTCAATTTCGTAATTTTTGGCGGGAAACCATCA
CTCTCTCGATCTTCCTGCAACTTGCAAAATGGGACGCAAGCAGATGGCTCTGGTGCCTTCGGGCCTGCCTTCATCGAACTTGGGGCGCTTTCACTCGGAC
GCAACTGATGCCCCTTTCCTCTCCGTCGTGTCGTGGATCTGTCGCTCCAGTGCGGAATCCTCACGAACGCGGCAATTGGCTCTGGACAAGGACAAATGTC
AACTTTTGGAGTTGCAGCGGCTACAGCCCGAGGAAGGCGCGCGCAGCTGGTTTGTGGGTAACTGCGTGCTTCAAGATGGAGGAGTGATGGTCTTCTCTCC
GATCGACGCGCTGTTCGTGCTGCTGGACGCTGCGTGGCCTCAGCGCACGCGCTTCTCGTCGGTCTACGACCTGCTGGCTAGGGACCAAAACACGTGGCTG
CTGCAGCTCTCGACGCTCACTCAGGAGAAGATCGAGACTATCTTTGACTTGCAGGCGGTCGGAGGGGAGGACGGAGTGGACAATATCTACGTTAAGGTCA
ACGAGAGCAAAGTTACGCGCTGGCTGAGGACAAAAGTGGAGAAAGTGGCGAATGTACTGACGCAACAGGAGGTTCAGACTTCGAGGAAGGCTGCAGTGGA
TGAACAAGTGACGCTACCAGGTGTTAAACAGACCGAGCAGAAGAACAACGAAGTGACGGACGGAGATGTGGCCAGACATTATCGAGAGGCTATTGATATT
GTGGGGAACTATCTGTCGGACGAGTGGATCGACCTGCTGTGCAATGAGCTCCAGTAAGTTCTACTTTGAAGTATTCGTAGATGGTGTGCTGACGATTGCT
TGTTGTGCTTTTAGGGTGAAGAAGGACGTGGAAGTTGTCAAGACAGCAAAAGCGGCTGCACCACTGGATACGTTTAAGCGGTTTGACCGTCGACAGGGGC
CTGAAAACGGCAGCAAGAGACCGACGCCGTCTGCTGCGGGTGCTGCGAAAAAGAAGAGCAAACTAGCCAATGTGGATCGCTCGGGCATGAAGTCGCTCAC
GTCGTTCTTTGGCAAGAAATAGAGGCAGAAGATACCAAGCGATGCATTGAGCGAAATATATAGAGCTGTCTATCGTCGTGACGTGGAGCCTTCCACGCTG
ACACGATGCACTATCACAAAGTCGTCCCAGCCGGAGAGGATCTTGAACTTGAGGAAGGACGCATCCGTCGGCTTGACGTTCTCGCTAACGATCTGCATCT
CTCCGTCGGTCTCCTTCAACTCTGGCAATAAGACACGCGATGGTTAGTACGGTGACGAAGAGATCAAACAGAATTGATCTGTACTACTAACTCGTGTCGA
ACAGTTTCTCCCATTTTGTAGGTGTCGGGCCGCTGCACGATTCAATCGACACCTCTTTCACATTTCGCGTCCACATCTTAGTACGAATGACAGAAGCCGT
CGTCGCCAATTGAACCACGATTTCTTGGGGAAAGCTTCCAGTCGTCACCCATTTAGACGATTGTTCCCTGCTCAATACAAACACGAAAGAAGAGTAAATG
GACTGAAGCTTGCAAGCTCACAATTCGTTCATGTTTACCCGTCCAAGATGTTAACCGGCGGGAAGCTCGGATCGTACGAAGTCACGGCCGTCACCTGAGC
ACCTTCTTCATCCAAGGCGAGCTCCATCACGACCACGACGTCTGAAGGCTGTTGTGATGTGGCTAGTTCTCAAGTCCCTGGCAACTACATTGGCTTTACT
TAGAAACGACACACAGAGCACTCCAATAATAGCTGACGGCATGCACTCATACTAATCGTCTTGATTTGCAACCACCTTCCTAGATCCCAACGCCACAGCT
GGCCAACTCAGCCACTCGACCCACTCCGTGAAGTAGCTCGCTAGCTCAAGGTCAACGGCGGCTCGATAGACTCTTTATACAAGCGTTCGAAGCCTGCCGA
CAGGATGTCCGCCGCACGCGTGATTCCCGACCCGTCGTCATTGAAAATCTTGCAGTTCGACCACATCAGGCGAATGTCGTTGGCAAAGTGCGTGAAATCC
AGCTCCTTCACGCCAGACGCCACGGTGTTGCTGTCCACGATATACGCGCCCTTCTTCAGCTTAGTCTCGATCCTCGACAGATCCATCGGTTGCTTGACCA
CCTTGGTGTACAAAGGCACATTTTCCACCGGCGTCAGGAACGGCTTTGAGAACGGATGCGACTTCAAGCACTCGACAATTTTCAGGCACTTGTCGAGCAG
GCTCTGCTCGGAAGCCACCGCCGTAGAATACGCATCGAACCGCGATGGCTTTTTGCATTCCTTGCATTGCCAGTCACCTTCGGGCAGGTCGTTCTCCGTC
ATGTGCAAGCACTTTAGGTGGAAGGAACGCGGGCATTTGTCACAGCAAACCAGATCGCCAGCGCGTTGACACACCTCACAGAAATCTAAATTCGTGTCCA
GTTCGCTGTCCGAAGCATCTCGTCCGTCTCGTTCGTCTTCGTCTTCGTCTTCATCTTCCTCATCGTCCTCTGCACGGTAAGCCTCTTCCTCCGTCTCGTC
GTCCTCTTCACTCGTTCGTTTAGGGCGTTTCGGGGGTCTACCTCTTCCCCTTTTCATAGGTGCGCTGGTTTTTTGCTGGCTATTCCTTGGCTGTGTGTAC
CCTTCAGGAAGAGGATGCTTGCGAGGACGCCCTGGTCCACGATGCAGAGGTGGCGGCGGTGAGGATGGTTTCAGATCCAACACAGAATGGTTTCCCGTTA
TCTCTGCCTTGGGAACGTTCTCCATCTTACGGGTATCGGCCTTCACGCTAAGCATTGGGCTTCCATCGGAATGGTCTTGACGCTTCATCTCATTGGCCTC
TTCTCTCGCGGCGACTTCGGTATGCTTTACAATAGGGGCATCATCTCGTGATGACATATCGTCCGAGTCGCGTTGCGCGGGGCGTTCCTCTGTTTCACTG
TCACTAGCCGTCCGCGTCGGGTACTCCTCGACAGGCCGTGCACCAACACTTGGACGCTGCGGACTATCAGCCGAATCGATCGAGCTAGTGGACGATTGCT
CCTGATATGGGCTACCGGTTTGGTTTCGCCGGTCAGCAACAGCAGAGTGCGTTTGGGGGGCCGTTTCCATGTCGACATCACCCGAACCTTGCGTATTTTC
GCTTCTCGGTGCAATTCCATTCGAACTCGGACGTGCTTCACCTTGGAGATGACTACTAGTTTTGCTCGATTGGCTGCTGGTGGAGGTCGCAGGCTTTTCA
CCTTGATTCAACGAGCTCAGCAACTGGACCAGAGATTTCTCTGACTCGACGCAGTTAATGACAGTATCCGCTGATGGAGACTCTACAGAGCCTTGGTGAA
CACGAGATGTTGCAGCTCGAGCAGCAACGCGAGGGTCAGTAGCACTATCAGCCATTACAGAGAGCATATCGGCAGGTGTATCCTTTGCTGCGCGCTTCCG
AACAGCAGCGTAGTGAGACGGAGACTTCGACTGTGTCTGCATGCTAGGAGCATAACCATCGCGACTACTCTGTTCATCCGCTTCATATTTGGTCAGCTGA
GTCTGTGTTCGCCTGCGTTCTTCATGCGTTTCTTTAGCCTCTGCACCGCGAATAGTGAATCCTTCACCACGTTGAATAGGAGGAGGACGCCCTTCTGCTG
GTGGGGCGGGTGGGTACTGGACGTAGCGGCGGCCATTGCTACCACCCACCTTGGGAGCACTGCCATAGGTCAATCGGCCTTCTGAGGTCGGAGTAGATAC
AGCAGTCGCAGCAGAAGCGGCAGTGGCGCTGTCGTCTTTCACCGCAGTCATTAAGCCCTGCCCGCTCCGGCGCAGCGTATCCAGAAGATAGCGCTTGTAC
TTCTGCACGTCCTGCTCCTTGTCCGCTGTGCATCCGGTACACGGACACCCGCGAGTACAGACCAGACAACGCAACAACCGGCGGTTCGGCGCAGATCCAT
TCCTGCCAACGAATAAAGCTTCCATCCGCACTCTGTAAACGCTTCGCAGATGCTCCCGACATAGCGAATGGTTCTCATCCGCATGCGGGCAAAAATTAAC
CACAGGCACAAAGTGTTTTTCGCTCACTCCGCACAAGTGGCACAATCCCTTGGCAACGAAGTTGGCTTCCTCTTCAGGGATTAGGTCCTCCATCGCGACA
GCAAACGCATCATGCAGGACGGATTCGTCCAGGTTCACCTGTTCTCTCAGCATTTCCTCCACCCTGGGAGGCAGTTTCCTTTCCCTCTTGTAGTCCTCGG
CCATCTTTCCCGACGAAGAAGTTGGCACCGGTCTGTTCTGATACATCTTGCTTGCAGTAGAACCGTCCATAACTTTTCCCTGATAAGCAGGAGAGCCCTG
GATAAGTCTACCCTGATAGGGTACAGATCCATCCGCCATTCTCCCCTGATAGCCTGCTGGTCCGTTGGTTGTTCTCTCCTGATATCCGGCCGGAGCATTC
ATCTGCCTCCCTTGATATCCTGTCGCTCCGTCCATTGGCCTTCCCTGGTATCTTGAAGGCACATCCATCGTTTTAGTTTGATAGCCAGTAGAATTATCTA
CCGTTCTCCCCGGATACGTAGCAGAAGTAACCACTGTTCTCCCCTGATAAGGACCAGAAGTAGTTGATGTTCTCCCCTGATAAACAATAGGTCCATCCAT
TGTTCTCCCTTGGTATCCTGTGTCCATGGGTCTCGTCTGGTAACCTGCTGAATTGCCAGGAGCTATCCCCTGATAAACGACAGGTCGTTCTACCTCTCTT
CCTTGGAATCTCGAGGCTGTAATGTGTTGCTGGTATTGCGTAGCTCCCGGGGGCCCTGAGGATTGGGGAGCCGCCCAATCGCTCGGTCTCGCTCGGTCTG
GCCAAGCTCCAGTGGACGATGTGGCCACCCCGCGGGCCGAAATGGCCGAGGCGGGGATGTAGCCATCTGGGTTTTTGCCCTTGCTCATGATGGCCTCCAT
CCACACTTCATTGGGCGGGGGCGTAAGGCGCTGGCGCTTCTAATATCGACATTTTGAGCAAAAAGAAGAAGAACAACAAAGGGGGAAAAAAAAGTTAGCA
AGGGGGAGAAGAAGGGGGAGGCACGACACGAAGAACAGCACCTTGTCCCCGCGGTCCCGAGCTGCCCCATGGTACATGCTGCTGGCCGCTTCCTCGACGA
GGCGTCGGCGGCTTGTGCTGCCCAAGGCTTCTTGAGATTTGTCGTTTAGGCACCACAGAGACTGGGGCTTTGGCGCGAGTCAGTGACGTGAAAACGCATA
CATTGTACAATAGAGTACGGAAATGATGTTGAGTATGTGTTTATGGAGGTGCCCATCGCGCTTGGTGCCGGACATGTGCATGCTGTGCCGACACTGCGAC
TCCACACCATCACGGCAGTTGTGGCACACAAGCTGCCAACTGGCAGCTTTGATCCTTGAGATCTACTGTACAAGCTCGATGATGCACCCTGTCCTTGGGC
TCGCATTTTAAACCAAAATAAGGCAACTGTTTTGGACGAGAAGAGTTTTACAATTGATGCCACTCGCAACTTTCCGTGTCATGAATACAATGTTCCCTGG
TAAGTTTCCTTCTCAAAATACTAATGCTTAGAAGAGTTTCTATCCAACCCAGTCTGTTGAAAACACAACACCATAACCTCTGCCGGCGATATGCCGCCAG
ATGATCCACATGTACCCGTTCCTAGTGTTGCAAGGAGCATTCGTATTATGGATAACGATCGCCTACAACATCATGTTCAACCCTGTTCAACGTGTAGACA
ACAGCAAATTGTAGTGGTCTAAGTTTTTTTTTAATGAAGCATATCCGTAGGTTGGAAACTTTTAATAAGTTAGGCAGCCCTCGTGGGCTTGTACATATTT
TTTACCTGGTACATGTACAAACCCGATGCATACGGCATGTATTAATACAGCCAGCTATTTGTCTTTAGTGTATCATTGTCAGAGTTAACGTTAGTTATTT
TGAACTTCGAAATTCGAACTACTGTTAGATGCGCGCAGCCTTAAAAATGTTAACCCTTTTACTGTTCAACCTCGCCGTGAAAGCATTTACCTCGAATTGC
ATGTATATCTGTAAAATGATCTGGTACTGAAGCTTCCACTCTAGGAGTCCCAAGTGTTTGTTTGGTAAACGGCGATTGTTCCCCCCTCAATTTAGAGCGG
GTTTCCCCATTTACCTACGCTCGAACTTTGAGTCTCGAAGTTTCTGAAAGCAGAACTTGCACATCTCGTAGTTGATCTTTGATCTGCTTCGAGATGTCCT
TGTAATTTGTAAGCTGACAGCGGATACGGTACTGCACTTCCCTCGGCAGGATTAATACATGTACATGCCTTTCATACATGTATAACCTTAGTACATTGCA
TGTGCATTCGTATAAGTTCTATTGCAAGCTCCAGTCGTGCAGTTCAATACAATTTTGAAGCGAGAAGGTTCAGGAGCTTAGTCACCGTGGACATACTCAT
TTTGTTTGGCTCATAATGAGTCGCTCATTATCGAACATAAATATACCCTTGTACGCATAACGTTACCGAAAGTAGATAGGTAAAAATTGATTAACTTTAG
CTGGACTTACGTCATGCTATTACCAGTGTCTTACGTCTAGCATCGCGGAGTCCATATTCGTTGTCGTGGGAGGTTAGGAAGATGTTCGGTCCGTTCTGAC
TCGAAACCCAAGCGCGTAAGCACTCGATTAAGCGCTCCGCCGTCAATATTCCAATCAGATGAGTGTCGAAACAAGAAATGGCAGTGGCTTCGAAATGAAG
CCTGCAAGTTAGCGATATTTGGCGTCACCGCTTGTGTTTCGCCGAAGTAAATATCATTGCGCAGCCGCTA