Description :
From Genome Similarity Track
Location :
Scaffold_668:361- 16180
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_668-snap-gene-0.0Regulator of chromosome condensation (RCC1)

Sequence
15819 bases(100 bases per row)
ATGGGCCAGCAGGGGTCTCATCCGATCGCGAGCGGCGCGGGTGGCATGCAAGCCACAGGGACGCAAGCTGACGAACGTCGCGTGGCACGATTGCATCCGC
TACCGCCAATGTATGTACCGCTGTGTGATACAGTTAAAGCCGGAGACCCTGCTGGTGGTGCCGTGAGCGTGACGACCGAAGACATCAAAGACACACTCGG
CAAGATCTTAGAGTTCAACCACTCGATTCGGTTCCTCCCTAAAGGTACGTTGATGAAGTATATTGATGAACAAAATATCGACCTCTCAGATTTCCTTACG
CTTACTTTTGTCTATAGAGAATGAAGTCAGCGGCGCGATCACGTCGCAAAGTGCAGAGCAGCAACTGCATGAGATCGTAAACTCGGTGGATTCCGTGAAC
GATTTGTTCCAGTATATCTCCATTTTGGCGTCGTTGCCCATTGACCAATTTGGTCGAAGTAGCGTTGAGTCACTTCATATTGCGGATGACTCGATGAAAG
AACATGGTGCGACTCCTGGTGTCTTTGGTGCGCGCGTTAGCAGTTATGTAAAAAATTTGCAAAGTCTGTATCAACTTACCAAGAAAGAAAAGTATCGATA
CGAGCAACGGTTGACGGCTGCACGAAGTCTTGCAGCATCACAGCGGAAGGTGACGCCACCACCTCTTCCATTGCCGACACAAAACTGCATGACAATGGGA
TGGGACTTAGTTGTGCACTTACTCAAGACTACGCGAGCAGATAATCCCCAGCACTACTTGCACGCGTTGCAAATGATAAAAGACAATTTCTTGCCATTGA
AACCGACAACGTACTCAGATAGTATGTATCTGGCGCCTTCAGCATCATCAGCGTTCAACCTACTCAGTGAATGTCTTGGCGAGCTAGCATATCCAGTGTC
AGGCAATATGTCTGCTGAAATGGAGATTCGTCTTGGTGCATCGACCGTTGAAGCACTCGCAGAAGTTGGTTTGGCGCGCGGCTCGTTGGCCACAGTGCTA
TTTGTCGTGTTATGGCTCATGAAGCAGCCCTCGTCAACGTCTGTGAACATCGGTGTGACTTTGTCCAAATTAGCAGCATTGAAAGAACAGCCTATGTACG
GCAAATGTGAAGCGTCAGGAGAACTTTATTGTTGCGGTCAGAACTCATACGGTGAACTCGGTGTTGGTGATGATATTGAGAGACACCAGTTAACCAGTGT
GTCGTTGTGTGGTTGGGATGATATCCGACAAGTCGTGAGTGGCAACGAAACGCTTGCCATCCTCACAAACGACGGTGTAGTTTTGACATGTGGGCTCAAC
AAAAGTGGGCAATGTGGTCAAGGTCATTTCGATGAACGAGTTATGCTGCCTCGGCCAGTTCAAGCGTTGCGCTCTCAGAAAATCAAGTTCATTGCGGCCA
GCAACGGATGCGAGCACATGATTGCTCTGACTGAGACTGGTTTGGCTTATTCTTGGGGTTATAACGACCGTGGGCAGCTTGGGCATGAAAATTTGACGAC
AAAGATCCATATCCCAAAGTTGATCGAGTCGATGAAGGATAAGAAGCTCAGTTTTGCTGCAGTGAGTTATCACCACAGCGCCATGGTAACTGATACTGGA
GAGCTTTATACTTTCGGGATGAACGACTGTGGTCAGCTGGGACTTGATCACACTCAACATCAATCGACTCCGCAGCTGGTGAAATCTCTCGAAAGTCAAG
AAGTCACGATGGTGAGCTGCGGTCTTTACCACACGATAATTTGCACAGCGTCAGGTGAGCTTTATTCGTGCGGAAAGAACGATTACGGTCAGCTCGGCCT
GGGCCACAGCCGGCAAGTGAAAGTTCCAACCCTGGCGGCGGTACCAAATGAAATGATCTGCTTCGTCGCATGTGGCTACTATCATTCCATCGCAGTAAGC
ACAACAGGACGAGCGTATTCATTTGGACGCAATGATTACGGTCAGCTTGGCATCGGTACAAAGATCCATCAAAATATTCCCAACGTTGTGGCGATTTCAG
CAAATACCCGTATAATTCGTGGTGCTTGTGGATGCTACCACACCGTTTTACTATCAGAGCAAGGACAAGTGTTCGTGTTCGGCAGAAACAACAAAGGCCA
GCTCGGCAATAGAGGAAGTTCGGATTCCTTACTACCTGTTCCACTCAAGGTCCGACCGGAAAAGAATTCTCGACGTTGTATCGACGTAGCCGCGGGATTC
TATACAACATCGCTGATAGTTGAGCGAAAGCGAGAAAACGATGATGGTGATACGGTTGTTCTAGACCAGAGCTGTATTGTATCTATTTGTGGCCGAGTTG
ACCTTGACCGCTCCGGCGAGATTGAAGGCTTGAGCAACTTCGGATCAATTTCAACTGTTGGCGTATCTTTGTTCCAGGGAAAGTGGTTTTACGAAGTGGA
AGTGGTGACCAGCGGGCTTATCCAGATTGGCTGGATTGATGGGTACTTTCAAGGAAGCTCCGATCAAGGTGAAGGTGTTGGAGATCATTCTCACTCTTGG
TCATACGACGGAAATCGGCAACGAAGATGGAACAGCGGATCTTCTTCTTATGGCGAAAAGTGGAAAGCTGGTGATGTCATTGGATGCTTGCTGGATTTGA
CGACGTGCGAAATGTCATTCTTCCGCAACGGAATCAATTTGGGGGTTGCGTACTCAGATTTCAAATGCGACCCATCAGATAAGAAGACGGGATTAATGCC
TGGCATCAGTCTGGAGAGAGGTGAAATCATTCGTGTGAACCTTGGTCATCAGCCTTTTGCGTACCCACCAACAATTGCGAGTGATTTTGACAGTATTTCG
AGAGCTATAGTGACCCCTGCATCCAGTGCTGTGCTCAAGACTCCGAGTAAAGAAGTCACGGATGCGTCGACTTACCCTCCAGTATTAGAGGGGTCTGCAT
CAGTTTTGGTAAAGAATATGATGTTTGTAGTCGGTGGGAGTGTCATGGGCAGTATGAATGGAAATGAGAATGCCCAGAGCAACCAAGTTTGGGTATATTA
CCTGGAGAACAAACGCTGGGAAAGATGGACCGATTTTCCGATAAATGTTTGCCATCATCAGGTTGTCGCTATTGACGACGACCATATTCTGGTAATAGGA
GGTGAGAGCGATACCCCCTCCTCACGTCATATGGATTTGTACAAGTGCTCGACATTGAAGAATGCAGATGGGTCGCTTCCGTCATGGGAATTGATTCAAG
GCTCGATTGGAGCTGCAACGTCTTTGCCACAACCCCGAGCTTTTCACACCGCGGCGTCAATTCGAGTTCGACTTGATTCGATGGTGTTCATGTATGGAGG
CAAGTCGACAGATAATGATGTCCTTGGAGATGCCTGGTATTTGTCCCTTGATGACTACTCGTGGTCTCGTCTCCCAAGCTCGTTATCGTTGGATCCAGGT
CCAAGAACCGGCTGTTCGTGTGCCGTGATTGGAGAATGCGTGTACGTATTTGGTGGTCAAGATAAGGAAGACAAGCTACGCGCAGATCTGTGGCGGTACA
ACACATTTGATCGTCAGTGGCACCTATGCCATGATGATAATATCTCAAGCCCGCAAGACACAAATGGTGAGAGCTCACTTCATCCTCGAAGTGAATTCAA
CCCCGTAATGCCAGAACCGCGAATGAACTACAGCATTTGCGCTGATCTTGGGAACGTGTGGGTATATGGCGGAGTGGATCGATCAGGACAACACCTGAAT
GATTTATGGTACTATTCCATCACTTTGCAAAAGTGGACTTCTATTGAGCTAAACTTCGAAGACAACATCGAAGGTTGGTCTTGCGCAACATTGTTTGTAA
TGTCAGGAATGGCGACCGCGCTATACAGTGCGTCAGATTCTATCCAGTCTCCTCGAGTGGACGGAAATCTTCATGTATTCGGAGGAAGACTGAAGATGAG
TGGTGCAGTGGCTGCGACGAATCGATTGTGCTGCATTGCTACCTCAGACTCGACTAGGTCGTACAATATCGATCCTGCGAAAAGCGTATCGACTGTCGGG
AAGTCGGCCCATGTTTTGGGAGTCTTGAGGGCAAAATGTGGAGCTGGAACTAGCAAAACTACGCAGCATTGTGTTCATGAAGCGCTTGACTCCGCTATCT
GCATGCTATCGCATTTGGATAGACTAGCTGGAAATGATATCCCCTCTGAAGACACCGAAACTATTCAGCTATCTCGGTGTACTTACCGGTCACTTTGCAT
TGATCCCAAGGAGAAAACTTTCTCAGCGATGCACTTGCTACTGGGTAGTATTGTTCCTCGATTCGTGGGTGTGCAATCGTTTGAAGAGCATGCCAATCAC
AGTGAGTATGTAATTCAAGTCCTGTATCCGCTTTTGGTCACGACACGACTTCTCAAGCTAAATTTTTTTGAGGTGAGTACAATTACGTTAGTATATATTT
ACTCAGGTATCTCACTTCTTGTTATTTTTTTATTTTTGTAGCTATCGCGCTGCTGCTTGGATACTGCAGAAGTTGGTCTGTCAACACTTTCGACGAAGTC
GGGTGGTGTCCTTCATTCGATTCGTGAATTGCTATTCCAGATAGCAGAGCACTCCCCAAAGGTCCCATCATCTGGGGAGCTGCTGTGGTTCTATCATGCT
GTGAAGCAAGAAACTGCCTCATCTATCTACTATGGGTTCTCGACGCTGTTTCCGTCTCTGCTCGATAGAATTCAGGTCATGAATCGGTTGCTCACGGATA
CGTCGGCTAGTCTCGGTGATTGCTCTCCGACGAAAAAGCTGCTAGTCCCTATGCTGGTACCATGCTTCACGTCTGCAAAGATGCTGTTTCAGCTGATGAA
CGAATCTCGTTCTCTTTTCGAATCACCTGATGCCACGCTCGCGTCAACGACCGTCATCATCAAGTTTGTTGATACACTTACGGACGCTTTATGGAGGCAA
ACATGCGACCTTCTGGGTGATTTTGAAAAAATTGGTGAGACTCCAACGCCAACAAAAGCTCTTGACATGCTCGAAAACAGCTATGAGTTCAAGTGCCTCA
ATGTGTTGCTACGAGCTGCGATCTATTGGTGCTCACTAAACGCACAAGATGGATGGCATATAATCGAGTCAGTGTGCTTGAAGTTTGTGCTGTTCACGTC
GAGAATTCTTCAGCGCGCGACGTCAATGCAGGACAAGCAAGTGTTGAAACTACCACTCATTATTCAGAACACCTTTGCAGGCAAGTTACTCCCATTCACT
CTGCTAAGTGTATTCTCGCTCCCGTCAATCCGTCAGTCTCTGCCTTCACTTTTGGATGACTTCTGGCCGCAGCTGGAGCAGCTGACGTTAGTAATTGATT
CGGCGTTGAAGGCGTTGAGTAAAGAGAAACTCCAGGAACAAAAATCATCGGCGAGCGTTGCTTCATCTGGAACATCAAGCGAATTCAATGATGCTGACCT
GGAAATCGACACCTCTCAAGGTGCTCGAATTTCAAGGGAGCTAGCGACTTGCTTGTCACTCAGTGGAGATCTGACTTTTACGTACGACGAAATTTTCAGG
AGTATTTGGATGAAGACTAGCAGCTACCCAGGATTCAAATGCCAGAAAGTCAACGACTGCCAAAATGGGATCGAACTGCACAGAATAGCAATTCCGTTGG
ATTTGATGAAGCTATTTTGCGCAGAAACTCTGCTGATCAAGTGCTTTCGAGATTCGAGTGCACCAGGACGACAATTGGAGTACGATCAAGACAAAGTCTC
GTTTTCTCCGAATCGAACAATATTATCGCAGCATATATACCCAATGTCTCCAGTAGTACCGTGCGTGAAGAGTGTGGAGTCCAGTTCGAGCTCGCCGGAA
AGCAAAATCGCTTCAAAATCATCAAATGCAGAGTACCAGTTGGAATTTTTGGACGTCGCTTTGGAAGATGGCTGCGTTTGGCTACAAGATTTACAAAAAA
TCTTGGTCTGGGTAGGCAGTAACTACGCTGCGACATTGATCACTGGAACCGAACCTCCTTCAGATAGCGTCATTGATCCGCGGTGGGCTTCATCGCCACT
GTTTCAAGGAGGGTTGGAGGAAGACTCGGGTCTCACAAAGCTTCTTCGAGATGACTCCCATCCAGAATCTTTGAATTGTAAAGTTGGGCGAAACGAGCTA
CTTTTGCAACAAATTGTCGAAAACAGTGGACCTGGCAAGAAATTGGTCGACAAGGTGCGAAATGCTCTCGATCCTGGTGCTGGCTTTGGTGGGGGAAACC
CTCAGCTACGAGCTACCCGCCTGAAACGACAAGATAGTGTTGATGCGGCAATAGAGAAAAGTGGGGGCTATGAGGCTGTCGACCGAGCTGTGCGAGTTGC
TTTCGCCGTTCTACTAAAGCATAGCAATATTTTTTACATGGCTGAACCTCTGTCAAGGGATGGCATTCCTTCCGAAGCCGTTGTTGACGCGTGGAGATCA
GCCTTGCAGCTTCGTCGATGGTAAGTTGTAGATATACCAAACCATATCCAGCATCCAGCTGATTATGTATGCGTTAAATGTACAGGATTGTCCGCGAGCA
GCAAAAACTTGCAGCTTCTTCAAGGTAAGTTTAATTCTTGAACGCAAACGACAGATTCGATACCGTGGCTGACCAGATTTGTTTCTTTGTTTTTATTCAG
TGAGAAAACGAGCACTGATGTCGTCATCTCTGAGGCTGATATGAAGGAGCGTCAACAAACTTTGTATAACGCAGTTTGTGAGCCGATTATTCGCCGAGCA
CTTCTACTGCTTCAGTTATCGCCAGCTCCAACCGTCACCTCGGGAGCTTGCTCTTCACCCTTGAAGTTGCTACCAGGGATATCATCTACTCCAGCTTATG
GTAAGGTTGCCATTTCTATTTTGTAATTTGTATGCAACCTTTTGGCCTAACGCCTTCTCTCGATTACGTTGTTGCGGCAGATTTTTCCAAGGCAATAAGA
GACTGCACTACTGCTGGACCGGAGAAAACTCTTGAAGAGCAATCTGCGAGACAGCTGAATAAGTTGATGCAAGCGAAGTCAGTTGAAATGATTGAAGAGG
AAGACGAGCGTATCCAGTTGGATATCTTCTCCTTCTTACAGCAGTCCAATGCTCGTCCGACTAACTTGAATCAATTCGATGACGAGGCTCCAGTGAGTCG
AGAAGAAGCCATGAAGACAATACTAGAATCTCACCAGCATCGGGCTCAACAGCGTCTGAAAGGCATCAAGAGCTTCCTTCAGTTGCTTGAGTGCACTGAA
ACGATACCAAGCTCTCGATTTCACATCATCCCAGTGCTATCTTCGGCATTTAAGAGATCAACAACAAAAGCGGGCTACATGAATGAAGGCATAACAAGTG
GTGCGTCCATCGTGAAAGTCCATTATCTGGAGGATTTGGAGTTTGCCGGATCAAGACTGTCATCTATGATCGGTGAAGAGTTTTTCAACCTTCTCTCTTC
ACTGCTCGCATCATGTACCGAGCATTTGGCTGAAATCAAACAGCTTGTTCAATCTTCGAACGTGACAAGTGATCAGAAACCAAGGATGGGATTGGTGCAG
AAGGCCATTCATGACACATTGCTCGTTCTAGAAGCGTGTTGTTTGCCATACAGATCGAACGATTGGGATCATATTCACCGGATCAGATTCCCGTCGCTAT
TGACCGAGTTGATCAGTTGGACCAGTTGGAAAGACTCGCTTCAATTTGATCTTTGTGATGACTCCAGTTCTGATCATTTTCAATATGATTGCCCAATTCT
ACCTGCTGGAGCTGGCTCCAAATGCCCGAAGATCATTTGCTCACACAACGTCACGATTGGTACAGATCTTCACAAGCTAACGCTAACACACAAAAGTGAG
CTCACTGGCGACAGTTCGTCTGAGCCAAATGGCCGTCACGGTGGGTTGGCTGTCTTTGATAAAGCATTGAAGAGAGGAAGATGGTACTGGGAAGTATCTT
TACGTGCTCAGACCGACCGTCCTGTGTTTGTTGGAGTCACGTGCGGAACAGCGGATCTCAATTTCGTCGATGAAACCAGTCCAAATGGGGTATACCTTTA
TAAAGATGCACTTCCACCAGATGGTTGTGCAAGATCGGGAATCCGTTGGCGTGAAGCTGATGTTCTTGGAGTACTTCTCAGCTGCGACGAGCGGAAAATC
GATTTCTTCAACGCAACCAAATGCGTCTACAGTATTCTTCTTGGCTCGAATGAAAGCTTTCCGTTTGGCTATTATCCAACAATCGGGATCCAAGACGCCG
AAGTATGTTTTGATCTGTCTGCGCCAATTCCTGTCAAACTGTGGTCTCTGACGACTGCTGTTCAGTTCCAAAGTGCAGTGGTTTCAGGTGGTCTTGTGGC
CGCACCGTTTGACGGATCTCTGATCAGTTGGGATGGGAGACGGAAAGGCAGACACATTCAGCTATCATCGAATGCAACAACTATCGTGGCTGGTGATTCC
AATGGCAGTGATAACTCCTTCGAGACAGTCTTAGCGTGTCAGGGCTTTGACTCTGGGATGCTTTTTGTGGAAGTTCACATACTTTGTCCTGGACGAGATG
GCCGCTTTAACTTGGGTTTTGGAATCGTTGGAAGCAATTTTACCAACTTTGACGATGCCTTATTAAGTAAAGCGACACTCAAGTGTGACAGTCTGGAAGA
AAGTTGGAGCAAAAGTGTGTTTGGAGTGCTGTTTGATTTTGAAAAAGGGACAATCACGATCTACTCCAGCCAAAAAGATCCAGCAGTGTTCACCGTTGAT
GTTAGCGCCTTCAGGAAGCCATGGTTTCCTGCAGCCTCTGTTTTGTGTAACGGGACAGTCTGTTGCGTTAATTTTCACCCACAGTCGCGGCCAGAACTTC
CACCAAACACGTGTTACCCAGTCGGTCAACGCCACAATTTCCATCCAACTTCGTCTAATGAACTACAAATTGGGAAGAGCCTGCAGCTTCAAGTGCAAGC
ATGCGATGGTGGCGAGTTCAGTTCGTCTCACTCGCCGAGAAACTGTTTGCTGGACGATTCTTCAGTCTTCAGCTCTGCGAAGGGCAGTAATGTGAACTTG
GTACTGAAGCACGAAGTGGACACCCCGTTTTGCCTCAGTTATATTACCATTCGTGGGCCAGGACCAGGATACTCCAGTCCTCTTCGGCATGCGCTTGTGT
TTGTAACAAGCAGTTCGCCGGATCTAGAATGCTTCCAAGATTTTGACGACATGTCACCTACACAATTTGCTGCACTGCCATTTCCCCCAGCGAATGACAG
ATCCCAGCGAGATGAATTCCTCCCAGTCGCTTACTTTGTACTTGATGGGAGCTGTGCACAAATCTCAAAGCAGCTCGTATGCCCAGTTACAGGAAGATAT
GTGCTGGTGAAGTTAATTTGCCCCTCCTCTGGATCCAATATTGATGTCGGGTACATTGGATTTTGTGGTGCGTTTGATCGTGAAAACGGGCCAGCTTACA
ATGAGCAGGCAATTAGTTCGTACAGCTGCGAAGAGTGCAAGAGGTCCCCGTTATCTGGTGTGTACTACGGACTAAAAGATGACGACACCGTCAAGATGTG
CTCGGCTTGCTACGATGACAACCGAGGTTCACTGGATGATCCATATTTCGCGCACATCACGGCAGTTGAAGGTCACAATGGCATGCACATTGACGAAGGA
GCTGTGCTGTGTGCTTCTCGAAAGTTTTGGTACGAGAAAGTATCGGCTCTTCTTGATATCACAAAAAAATCGAAACCCTCACTGACACCGCATTTTGATC
TCGGAGTTTCAGCATCTGCCAATCGACCAGGAGTATCGGAAAATGTTTCAGTCACTACGTTTGATGATTGCGAACTATTTTCATGCGGTCAAAACAATTA
TGGAGAACTTTGTCTTGGACATTGCAATTCGACTAGCAAACTGGAGCATGTTCCGTTTTTCTCGACGAAAAGTGTACGTGATATCGCCGGCGGCAATGAA
GTACTCGCGGTCGTCTTGAAAGATGGGACTGTATACACCTGCGGTCTCAATAAAAGTGGTCAATGCGGCAATGGCACTTTTGAAGAGCGAGTCATTTTAG
CCACTCCTGTCCGCGCGCTGAGTGGTATTCTGATTGACATGGTTGCTGCGGCAAACGGATGCGAGCATATGCTTGCTGTTGCCGCAGACGGTGCAGTTTA
CTCTTGGGGGTACAACGATCGAGGACAGCTTGGTCTGGGATCCACAATCTCGAAGAGTCACACTCCGAGGCTGATTGACTCCTTACGTGAGAAATATCAC
ATAAGCTACGCTGCAGTGAGCTACCACCACAGTGCAGTCGTCTCAAGCGCAGGAGAGCTGCTCACGTTTGGGATGAACGATTGCGGTCAGCTTGGTTTGG
ATCATACTCAACACCAACACACTCCACAACTAGTTGACGCGTTGTCCAGTCAAGTGATCACGAAGGTTGCATGCGGCTTGTACCACACCGTCGTCGTGAC
GGCAGGCGGGGAAGTGTATGCGTTTGGGAAAAATGACTATGGGCAGCTTGGCCTTGGTCATGCACGAAACGTGAAAGTGCCGAACTTGGTGAAGATTTCC
ACCAGTGACAACGATGAAAAGATTGTTGATGTGAGCTGTGGATATTACCATACTGTCGTGATCACAGAAAAAGGAAAACTTATCACTTGGGGGAGAAATG
ACTACGGCCAGCTTGGAATCGGCAGCAAGGATCACAAAAACACCCCTCAGTTCGTTCCGTTGCCTCTGTCATCGAAGATCACGAAAACATCATGTGGCTG
CTACCACACGCTTATTTTGCTTTCGAACGGTCGTGTGATGGTATTCGGACGAAACAACAAGGGTCAACTTGGTGCCGGAGCGAGGACACTTCCATCGGCA
GATCTACCCCTTCCGGTCCCTTCAAACTCATTATCGAATGATGACGTCGTCTGCATCGCAGCAGGATTTTACAGCTCCTACATATTGACAGGAAGGTCTG
GTCAAGGCCACGACCCAGAGAACGGAAAAGATGACCCAGCTCAACTAAAAGACTTGCCGGAACACAGCTGCTTGGTCAACTCGGATGCCCTTTACGAATC
GCTTATGAAAGAAATGGATCGACACAATGCGACTGAATCGGCAATCAAGAGAGCTCCAATTCCAATTAAGAGAACCAATATCCAACGGAAGCTGCCTCTA
ATGAAACTTCATGCAGCAGCATGGGCGCTGACGCGAGCATTGATGTATCAGTCGTTGCGGGATCGTGCCTCTGCTGAGAAGAGCAAAGCATCGTCCTCAC
CCAAGAAAATTGTGAACCCGGTCCTTCGCATGTTTACTGATTTTCTACTTGAGAATTTGAAGGTCGTTCAAGCAGAAACACTATCGAGGGATGCGGATTC
AATTTCAATTGATCCAGGAAACCGTTCGGAAACGTGTGTCAGCTTGAAAAATACGTGCATCGGGTTGCTGAAGTATTTTTCTACCAAGACTGTTGGCTCT
CCAAGTGATCACAACGCGCCATTTGATGCTACGTATGCTCATTTCTACCAAAATCAACTCTTGTGGGTGCTCTTGCGGTGTGGATCCGTTGACAGTGATG
TTAGTTCAATTATCGCTGGCAATCAAGACGTGACTGAGCAAGTCATTAAAGGTATGGATTCGAATGACTTGTCGTCTGCAACGATTTGCATTCGATTGGC
GATGCTAGTGTTCCCGCTGCATTCAATATCGTCGCTGAACAAAATCCATCGGAGCATTAAACCATCGTCAGCATTCTCAGGTGACATCATGAGTTCACTT
ATGCTCCTGGTGGGCAACCCGCTAGTTCTTCGACCAAGGCTGTGCGTACATGAACTCGGCATCGAATGCTCTAGTTCGGTCCTGTGCCACAACGCAAAGT
GTCTCAAGGGAGTATCAACTATTGGCGACTGCAATGTCAGTGATGTACAGATACATACGCTCGAGAAGAGTCACGTTGCGCTAGCAAAGTCATCTGAGGC
TCTGAGTCTCATCCGCTATTTGACACTGTATCCGACTTGGAAGGTAGCAGTCAATGCTGCTTTGAATCGCGGATTCGCGAAAACAGAGAAGCTTGGCGAA
ATTCTGGACACTGTGTGTGCGTATTACGCGAACGTTCAAGCCCAAGCATCTAGACCACACGTTTCCGCTGTCCAGAGCGTCGACCCAATCGATATAGCAG
AAGTGAAGCTGTCCATCGACATGACGAGCGTGCGGAAGCCAGAATCTACAAGTTCTCCTGAAATTGATGACAGTGCCTCTCCAGATGGTAACTCTTCCGA
AGATAAACAAGCGACGGATTTGGAAGGTGTGATCGACTCGAGGGACAAGAAATCGCTGATGTACTGGCAAAAAGCAAAGGATGCATTGGATGGATTGGCG
ACTATATTAGCTGCGATCAGTATCGTCGGTGGTCACACGGAGCTGTTCAGGGAAGGCGGGCATGTCTCTATTGAAGGCAATGAGCTTAACGGAAGCAACA
GATCGGGGTTGTTGGCAGGAATCAAGCAAGAGCCTCGATCTGATATCATGGCGTTTGTGATGCTCACGACCGAGGATAATGTGGAAAGCGATTACATGGG
CTCAACACCATCCACTGTCACCATTCCTATCAAGAATTTGCAAAGCCGTGAACTTGTTCCTGCGGTTCTGGGAATGTTTGACAATATTGACAGTATTCTG
ACTACTCTCTCAGCCATGATTCTACCCATCGTAGATGAGTTTGCAGTTCACTCGGAGCTTGATCAGCCTCAAAATAACTCTGTTCAGGAGATTCTTCGAG
GAAAATTGAAATTTTACAAGAAGCAGATTCAATGGCGATCGACAAAGGCTCTTTCCTCTCTGCTGATGCAAATGCCGTCCCCAATCCCGACCTTGGCAAA
TTCAGATTCTCAGCTTGTTGCCAATCTCGCAGTCTTGCTGGCGTCTGAGAACGCGCTATCGCATGGCAGTAACATGATGTCGATGAAACTGGATGGGAAG
CAATCAACGCGAGGGTTGGACGGCATGAATCTACTGCACAACAAGTGGGTGGGCCTGAAGCAACACCAAATATGCCTGGATACGGAGTCAGTGATCGATT
CTACGTTGGATCACTACGAAAGTGAAATACGAGAAGAAGTTGTGTCGACGCTGGGTAAAGAGAATGCTCTCAGTTGGGGCATTGATGCAATTCAGTCGCC
TCGTCGGAATATGACGACTGTCCCGCATGGAGGACTCAAACCTGGAGGTCCTATTGGCAGTTCCATGGGAGCACGTTCGAATGTGAATGTCCATGGCCGC
AACTCATCTAATGACTTTCCGTTCGGTGTCTGGGGTGTGCTACAACCGCTACCTCAGCTGAATGAAAATGAAAACGCCAGTGGTATATCTCACTCGGGCA
TTGACTTCACACCGTTCCACTTGTCAACACCGATTGTGCGTGTTGGCCGAGCTGCTGACTCGTGCGACCTTATTGTAAACGACCGAAGCGTCAGCGGACG
CCACTTCCATTTGCGGCGTATACGCCGTGACAATGAAACAAGCGAGGATTATTTTGAGCTTCAAGATTTCAGCAAGAATGGAACCATAGTGAATGGAGTA
CGAGTCCATGGCACGAGTGTTCGCATAACGCCTGGTTCCCGCATTTCACTAATTCTTTCTCGAGGTGGTTTAGTAACGTATGAGTTCCATGTCAGAGTCC
CAGCGACTGGTGCCAGTCGACTTGCACCGCCGCCAATTATTACGACACCTCAAAACCCTGGTGATTTGAATATCATGATTCCTGGGCAAGAGTATCAACA
ACCGCAAAACGGCACACCCGGAGTTGTAGAGCCTAGAAGTCCCGCGGAGATCCAAAATCGTGGAGCTCGAACGAATGAACCATCAGTGAATTCACGTAAT
CGCATTGCAGCAGCACAAGGACTGCGACTTATCACTTCTATTGCCGAGAGCGAAGTTCCACGAGCGTTAATTTCTCCCAACCCGGCTGTCGATTCACCTC
GTGTTGGTGGCTTTAATTCTCCACGATCCTCGATGCTACAAGCTCCTGGAACTCCTGCCGTGGGTTCGCCAACGGCAAGTATGTATCAGAATATGGTACC
ACCTGGCGTTCTTTCTCCAGCATCATATCAACAACGAGAAAGTATTATATCCGGGGAACCAGGAGGTATTAGAATGCAAGAGAATGTCGTAAACGAAGCA
TTGCGCATTGCGCTTGGAAGAGAAAGCGTTCATCGAGAAACTGTTCAACGGAGCGGTGCACAGGGTTTCTTCACCGATGACATTCCAAAGTCAAGGCTGA
CGACATTATCAGGCGAGATAAGCTTGGCCACTTCTTCGACTTCTTCAATGGTACGTTGAGATTGGAAAAAGGTATCTACTGCTATTTCCATGTGCGACGT
AGCAACTGATCATTTGACTTTGCAACTGAAATAGGCTAGAAACGATCTTGGCGGCATCACGATTGCATCTGAGCTTCATGCCCGATTACAAGATGCAGGG
TATGCAGTCACAAAAGACCAATGCGAGCAAGCGCTACACGCTACTGAAGGAGATTTCGACGACGCATTTGCATTCATCCAGTTGAACTATCCGCGCGAAA
TGGTAAGCATTGTTGTATTGTTATTATTTAGCTTTCATGGATCCGTGACTGATACACTCTAATTTCTTGCAGGTAAATACGATGCGAGAGTCGTTTCCGC
CCAATGTTCGTCAATTAGCAACTGCTTTAGGCAAACGTGAAGAAGTCTGCGCTGAAGCGCTGCGCCAGACCGAGAATAACTTTGGCGCAGCTGTTAGGTT
GCTGCTCTCTAGTAGTGGATCTGCGTTGGAGAGAGCAGTTGAACAAAGTCTACCGAGTCGTCGGCTTGCTTCTAGAGGCCGTGGCCATGGTGACCGCTTC
GCCGATTTACGAGATCAAGAAAGTGACTTGATGATGGGCTACCAAGATGTGCTTGACGAGAACCCGAGCTACGCGTTGACTGAATCAAGTGCGCTCCAGT
CAACGCGACGATTTGTCCGGTCAAATGGAAGTCCTCCTCACAAAGGGAAAACTGGAGGTTCCAATGGAGAGCTGATGCTATCGGAGTTATCGATGTGGAG
CGAGTGTAATGGGTGCTTTGATGATCGCGTGCGTCAAATGAATTGGCATGAAGCGGAGCAAGAAGAGGAAAACTTGAGTCACTTGCTAACAGCTGTTCAT
GCTCGAAGAGCATTGTATCACGCCGTTCGTCTTCTTTCACATGTAAGTGACCGAGAACGGCTTCTTTTTTACTCTTATGATTCTGCTGCTAATCTCATTC
GCTCTATTTTGTAGACGGCGTACGATGGAGACAATCCGCTCAGCGCAGTGGGCGATCGCCTCGTGCTGCGCCAATTGATTTCATCCTTAGATCCTTTGAA
AGCGACCTGGAACCAAGACGAAAGAGCGTATCGTCAAGCGAATGGGAAGATTCAGCAAATCCTCGACCGCGCTGCCAATGATGCCATGAGAACGTCGATG
TCAGGAACACTCACGAAGAACTTGCAATCCGTTCATCTTCTCTCAACCTTGACTCTTTCTGTGGATGCAACGCGTGAAATGGATCCGGAGTTAAAAAACA
TCGAATGTCTGATCCAGGCTTTGGTTCTTGAGAAGTCAAGTGATGACACGGATTCAAGAGCAGACAATGGCCATAATTTCGTGAAGCATACCCTGATTGA
TGATGTGATGTTCGATACGATGATGCACATCATCTCTCGAACCTTTGTTTCCCAGCCACGCTTGGTAAGTTGGGATACAGCTATTTCAAAGAACCGGAAG
CTGGAGTGCTTGTTCCCGAAGGGACCGTTCGCTCTATCTGGTGGTCTCGAGTGCATGGTTGTGAATACGTACGACCGAGTCTGGAGTGTGCCATCTCCAG
ATCCGTTGCTGAAATACCG