Description :
From Genome Similarity Track
Location :
Scaffold_49:36090- 38733
Transcript NameFunction/comments
g6941.t1hypothetical protein

Sequence
2643 bases(100 bases per row)
CGCGCGCACCGCAATTCCGTGCCAGGAACAGCGTGCTGCCAAAGAGCGAGCCCGCCGTGATCGAGCAGTCTGCGATGGGACCCGTGACCACGACGGGGTG
CAGCGAATGCCGCAGCGTGTAAAAGGCAAAGCCACCTTGGCGGCCCTTGAGCGACGCAAACGAGTGCGTCGACGGCAGGGCCTCCACCCGCACAGAGATC
TTGCCCGTGGTAGCGTCGATGTAGGTCATCTGGCGCAGGTGCAGATCCTGATTCGGGTCGACCGCCGCCTTCGCGATCTGCTCCTTCAGCGGTGCGCTAG
CCTTCATAAGGTGCCCCAGCAGGTAGTCGTAGCTCCAGGCGCCCACCTCGTCCTGGCTGCCCGCCACCGTGGCGCTCGCCTCCCATGGGCTCTCGATGTT
GGCGTCCTTCATATCGATGTCGAAGCCCATTTCGCGAGCAATCATGATGGCCTTCTTGGCACTACGCACGCCCATGACGTCGTCCACAATGTCGCGCACG
CTAAACTCGTTCTTGTACTCCGTCATGAGGTCCTTCATGATAGCACCGAGGTCAGCCTTGGCCGGCTCGGGAAGTGCAAACACCGCGTCGAACATGGCAT
GCAGAAAGCGGCTACCCGAGTACTCTACCCGCTGAATGTCGTCACCGGTCTGGATGAAGTTCTGAATCGTGTTGAAAATGGGCACACCGATGGCCAGGGT
TGCCTCCGGGTCGTACGTGAGCTCGTTGTGAACCGCCAGCTCCTGCATAGCGTGGTGCTGCTCGGTCGTGGCCGATGACACGTTGATGTTGGACGTCATA
ACGTGCACCTTGCGGGCCAACCACTGCGGGTACAGATCCTTCACGTGGTGCGAGCTGTTAGAGACATCAATGATCAGCCAGTGCGGCAGGTGGTCGGCGC
AAACGTGGTTCAGGAACTGGTCCCGGTCGAACGGCACGAACTCGTCCTTGCGGGTGGCCAACGCCTCCTCCGTAACATCGCCCTCGAAGTCCAGCAACAT
CTTTGATGAAATGTGCGTACCGATAGCACGCACACGGATGTCCACGTTGAAACGCTGCTTCAGAAAATCACGCTGCTGGTGGTACTGCTTCAGCAGAGCC
ACGCCAGTGCTGTTGGTCTCGTCTTCCTCGAACTCAAGGCCAATCAGACCGATGGAGAGGGTCTGGTCTGAAAGGAAAAACGACGAGTGCACGGCACGCA
GAGCGGCAGCCGAGTCCTCGTATCGCACCACAGCAGAAATGTTGCGCTCCGACGATCCTTGCGAGATGGCGAGCACGTTGATCTTCGCCCGGCCCAACGC
GCCGAAGAAGCGAGCGCAGACCCCTGGGGTTTGGTTCATCTGGTCACCCACAGCGGCAATGATACTGATCGGCGCGATGTACTCGGCCTTGTCAATGTGT
CCGACGTGGATCTCCTTGAAGAATGTCTCGTTAATGACGTCCTTGGCTACCTCGGCGCAGTCCATGGGCACAGCAAAACAGATCGAGTGCTCCGAACTGG
CCTGGGCAATCAGTACGACGTTCACCTTGACGCGGTCCAGCGCGCTGAATAGACGCGAAGACGTGCCGTGCACGCCCACCATGCCGCTGCCTTCAATGTT
AAATAGCGCCAGGTCGTCGACAGTGGAGAAGCCGCTCACAATGTTGCGCGCAGTGGGGGCGCCGTTCGACATGGTGCGCTTGAGCTCCACCTTGTTGCGG
TGCGAGATCTTCGTGCCCGGATGTTCCGGCACAAACGTATTCCGGATGTAGATTGGAATGTCCTCAGCAATAGCCGGCGCCATGGTCTTCGGGTGAATGA
CCTTAGCACCGAAGTAGGCGAGCTCCATGGCTTCTTGGTACGAGATCTCCGGCAAGATCTGAGACTCCGGCACACGGCGCGGGTCAGCACTCAGCACGCC
GCTCACATCCGTCCAGATCGTCACGCTGCTGGCGTGAAGCACACGGCCGCAGATGGAGGCCGTGAAGTCACTACCGTCGCGCTTGAGCGTGGTCATGACG
CCCTCCGCCGTGCTACAGATGAATCCCGTGACGACGAGGTGCGTGAGTTCGTCTTCGCCCTCGCCGCTCTTGAGGATCTCCTGCATCTTCTGTGTGGACA
GATCGTACTGCACCACCGGCCCGTGCTCGTTGTCGGGCTCGACCGTCAGGAAATCTCTGGCGTCCACGAAGCGGAAGCGATGCTTCTTGCCGTCCTGCTG
CACGCGCTGGCTCAGCACGGCCGTGAGGATCTTGGCGGACCAGATCTCACCGTGGCCCGAGATAAACTCCACCACGTTCTCGTTGTAGGCCTGCATGATG
GAGATGGAGCGCAGCAGCTCCGAGACGGACTGCAGGTCGCTCTCGATGGCCTTCTCGATGGGCGCGGCCACCTCGGCAGGCAGCAGCGTGCTCACTACGT
CGTGGTGTTTCTTGCGCAGCGTGGCCAGGATGTCGTCGCACTCGGCGGTGCGGCGCTGCTTGGCCAGCTCCAGCAGTGAGATGAGCAGGTCCGTGACCTT
GGGCTTGCCGCCGATGGCCGAGACCACGACGGCCACGCGCGGGGCCTCCACCGCCGACACGATGTCCGCCACCTTGGCGAAGCAGTCGGCGCTGCCCACG
GACGTGCCGCCGAACTTGTGCACCACGAACTTGTCTGCCATTG