Description :
From Genome Similarity Track
Location :
Scaffold_1521:3609- 5219
Transcript NameFunction/comments
Phyag_g10858transmembrane protein

Sequence
1610 bases(100 bases per row)
GACGACTACCTCGAAGCGAAGACTCCCAACCCCGCAGAACTCGAAGATGGCGCCATTCGCCCCGGTGGTCCGCCTAACCTGTACAGCTGGAACAATATCG
GACTAATGGCGCAGTACGCTGCCATCGGGGTGGTCTACGGCACCATGTACAGCGTGATCTACCCCTTCTTGACGAACTACCTTCGCATGTCTGGAAATGA
GACCACGTCCGCAAGTGTCCTGATCACTCTACCGTACACGCTCAAGGTTTTCATCGGTATCGTCACGGACTGTTACCCGATCTTCGGCTTCCGTCGTCGG
CCCTACATGCTCATCGGTTGGGCGGTGTGCTTCGTGTCATTGATCGTCATGGTTATCATGCCTATCGGTGACCCGTACTACCCGGACTCAAGCTGGGCGA
AGTTGACGACTCTTTCCGCCGAACAAACGGCGCAGCTCAACACGGATGCGCAGCATTCGGGCGTCAAGTATATTTTCCTCATGGTCATCGCCAACTTGGG
CAGTGTTGTGGCCTTCACGGCGTCGGACGGGATTCTAGTGGAGCTCGCCCAGCGTGAACCGTTAAAAGTCCGCGGCTCACTGCAGGCTGTAGTGTACGCG
GTGCAGTACTCGTTCCAGATCATTTCGTCGTCTATGATCGGTTTTGGGCTTAACAGTGCCGACTACGGCGGCACGTTCTCCCATTCCATGGGTTTCAATG
CCGTCATGGGCGTGTGCGCTGCCTTCTCGTTGGCTGTGATGCCTTTTTCGTGGTTCTGTATTACCGAAGAGAAAACTTACCACCGTTCGGCTCGGAAGTA
CCTCTACGCACTGTACGAACTCATCCAGCAACGCGTGGTGTACCAGATCGTCATCTTCCGGTTCTGTCGCAACGTGTTTTCGTATGTGTCTGTGACGGCG
TCGTCTCTGGTGCAAAGTTACTGGTTGACGGTGACGCCCGtgaacagcagcgcggcgtcTATCATCGGCTTAATTGTGTCTGCTGGGTCAATGTTCCTCA
CGAAGGAGTTCGGACTCAACTGGAACTGGCGATACATGATCGCGATCTCGCAGGTCGCTGTCATTATCATTGACGCGTTCCCCACGTTCTTCACCATTTG
GGACGTGTACCGTAGTCAGTGGTTTTGGCTCGGGGTTCCTCTCGTCGAGAACTTCCCCAGCGCAATCGGCACGATCGTCGCGACATTTGCTGTACTGGAA
ATCATTGAGGAAGGCAACGAAGCTACCGTGTACGGTCTGATCACCGCCGTGTCCACCTTGGCGTCGCCGTTCGCCAGCGTCATCACGAAGAGCATCGACG
gccacttcgacgtcgagacGGAGTACATCCGACTGGACAATTCGTACGTGCGTTGGCAAGTGACGTACACATATCTGATCGCCTACGCGTTCAAGCTGtg
ctcgctcgcgttcctggtgctgctaCCCAAGCAGAAGGTCGAGACACAGGAACTCAAGCGCACAGGTGGCAAGAACAAGTGGATTGGCATCGCCACGATC
TTCGCCGTCGCTTTCTCGCTCGTTTGGTCCGTCATGACCAACCTCATGACCATGTTCGACAGCACCTCTTGCCTTCGCATCGCAGGAGGAACCGGGTGTT
AATCTCAGAC