Description :
From Genome Similarity Track
Location :
Scaffold_27:3609- 4918
Sequence
1309 bases(100 bases per row)
TCAAAATGCGCTTCAGCCGCATATTGATATCGCCTGCAGAACTGAGTGGCTTCAGCTTCTCGGAAGGAAACGCCTTAGCCATTCGCAGCAGAAGCTGTAA
CACAGCGTACGCTTCAGAGCCGCTATCTCCGGCAGCTTCCATCGCTTTCATGAGTTGCTGTACGGAGCCAGAAGCAGTCGTAGCACGTCGAGTTGATGCC
ACATGGCTGATTGCACGCCCACTGCGGGTTCGTCGCGAAGTCATACTCTCATCAGCACCTTCTGCTGCTTGAGAAGCCATCTCAATCTCACTTGCTTCAA
CAACGGAGAACTTGTCTTGAAACAGTGATGTGCCCTGTGACTTGCTAGGCTCGAAGAACTCGGCATGAAGTCGTTGCAACAGATCTGCTGCGGTAAAAAC
CGGGATAAACTGCCAAATAGTCTCGAGCTCGTCTGCGATCACGCAAGCAACGACGAAAGCCTACAGTAGACAAAATACTATTAGAGCCTTGATCTAAGGC
GCGACGCGAAGTATTTGGCTTACCGTGAATGTGTCCGCTACTAGCAAGCCCAGGATCGTACCCCGAAGGCAAGCATCAATAGAGCCGAGGACCTATTACA
CCAAGAGAATATAGAAAGTTAGATCCAGCATAACTGCATACAAGATTCAAGTAGACCAAACAATCTTACCTTTGTGAACTTGCGGTAGTCGCGCTTGGTT
TCAGTGTTGATCGGGCAACAGCGTTTAGCTGTCTCCCAGATGACCTTTGCGTCGGCACTGTGCTCCAAAAGGGAAAATGTCCATCGGCAGAACTTCGTGA
CTGCTATTAGCGACTCCATCTCCTTCTCCAGAGACGGTGGACAGGGATCCGCAAGCGGATCGAACGGAGCAGGCGACCCAGATGCACTGCGATGTTCGTC
ATCAGCAACAGTTAAGAAAGATGCCAACGTGAAAGCACACGCGGACCATAAGAAAGGTGCGCCCTTCTCAAGGCTACCATGAGGCTCCCAAAGCGTCTCC
TCGAAGTAATCCCGCCACAAATCATGCTCAGTTTCATTTTCGTCGTCTTCAAATCCTCCATCGCGCCCAAGCACCGAACGATACCACCCCGGCATCGACA
ATTGCTCCTCCACAATTGTGTCCCATGTTCGAGACTTCGTTTCCTCGTCTCCGGACGCAACTGCAGAGCGTTTACGGTCATGCTCGTTCTCCTTTACAAT
CGAGATTCGGGGCTCGGAGGTAGGGATCAGGAAATTGCTCAACGTTTTGCACAGCGGGCAGAGGAACTGCGTCATTGCCGAATCCGGATCTATCGCTTGA
ACACCATCA