Description :
From Genome Similarity Track
Location :
Scaffold_127:36082- 38145
Transcript NameFunction/comments
Physo_143018single-stranded nucleic acid binding R3H domain protein

Sequence
2063 bases(100 bases per row)
GGGGTGCCGATTGCGTGAAGGGTATCTGTTGGGATGCTGACGTCCTTGCTTGTTCTGATACCGGAAGTCGCGCAAATGCTGAGCCGTGAGTGACGTTTTG
GGCAGGCCCTCCTCTTGCTCCAGCAACAGCAGATTCCATCTGGGACTGCTGGCCATTTGCGTAGCCTCGTGTAGCCGACACTTCAGTAGTGTCATCACAG
TAATCTTCAGAATCATACTCGACAGGAGACGATGGTGCTGTATCAACACCTCGAGCACCTCGAGCGGAGGCTGGTCCTTCAGCATTGAAATCACGACTGG
AAGAGAGTTGGTCCATCGTCACTTGCAACCCGACCGCTTCTGGCGACGACAGTGAAGTGGGTTATTTGACCGCCCGTTTGCCGTAGTCACGCGTTGTGGC
GCGGCCCACTACATATATTAGCAGAGAGAGAGAGAGAGCAATGTTAGATAGCGCAAAGCTGATTCGGGCATTCATTTAGCACTTACCGATAAAAGCACGA
GGAGCGAAGGCGAACTCTCAAAGAGGTGATGTGATTCAGGGACAACGAAGTTGTGGAGCTTGGGGGCCGGGAGAAGTGTTGAAGACGAGAAGTGGTAGAC
GATAGGGGTGCTCGAAACAGGGAAAATTGAAATGTGACGTCTCCAGCAAAGATGGTGAGGTTGCTACGCGCCACGGCGTCCTAGAAGCTGCAGGTGGCGT
ATGCAGCTGTCGCCATTTGCCTTTCTTGCGTTGGAACGATAGTGCGGCTTGGATACGCTGCCGGGAAAAGGTACCAAGAGTGAGGAAGCTGCATGTACGT
GCCTTTGCCTTTCCTCCACGACCCTACTGAAAGGGTGCGGCTTTATCCGAAGCCAATGGTATCTGCGCGAGGAGCCAATAGGAGCTCCAGGAAGCGAAGC
TGAGCCGTTTGCGATCCGTTACACTTCCTGTTTTTGCAAGAGTATTGGTTTGAACAGCAAATACCGATATACCGCCTTCAAACTGTGAAACCCCGCGCCG
ACGAAGTTGATAAACCGGTTTATCAAGTTCCTTTTTCTAAACTTGGGTCACTCACTCGCGTCCGTCCAAGAAAAGCTGCTAAGCTTAGAGACATGGCGCC
CAAGAAGCAGCAGAGCTCGCTGCAGTACATCACATTGACGACGAAGCTCCAGGAGCTGCTGGCAGAGCGCAACAACAAGCCGGTCGCGACAAAAGCGAAG
GTGATTGGGATCCACTTCCAGTTCGCGCGTCCGGAGGCTGCGAGCGCCGGCACGGACGATCAGGTTGTGGCTATCGCGGTTGGACATGATGCGCTCACTT
CGACGGCGGTCGTCCTGCAGGTCTCCTCCCTGGCGACCAAGGAGGTTGTCGCGGGGCTGAAGACGCTGCTGGAGGACCCTGTTATCATCAAGGTGATGTT
TAACGTTGGCCGTGTCGCGAGATGGCTACATCGCTTTGGAATGACTGGCGTCGCGCTCGCCAACTGCCTAGACCTGCAGCTTGTGTACCGCAAACTGGTG
AACAACAAGGCAGGCAACGCTAGCTTGGTTGATATTGCTTCGCGACTAGGAGGCAAAACTGCAGTCGCCTTAGAACAACAAGTCGCGAAACTCAATGCGA
ACATCAAGGCCGAAGCGTGGACAAAGTCCCCGCTGGCACCGCCGATGCTGAATAATGTGGTTGCGTCAATGCAGCTCTATGTCCGATGCTACACTGTCTA
CGGGATTTCCAGCGCCAAGCTACCCAGCATTCACACCGCGACGTACAATAGATGGTGCGATGCAGTGGCAAACCTTCAACTCCTGGCTCCGTTCGGAGTA
TCAAGTACGTAGTCTCGGATTTGGAGCTGCAGCGTGTCTTCAGCGTACTTGTAAGCAGCTACAACATCAGCCAAGATCAAGGCACAACAACTGTTCTCGG
CGTCCACTTCCAGTTCACTCGCGAAAGTCCTCTCTACCCAGGCGAGTACGACGATGACCAGCTAGTCGCCATCAGTATCGTTGGCGCTAATCCACTCGAC
ACGGCCATCGTGCTGCAACTTGACTCACTCAGCCCAGACCGCGTGCTTCTCGCCTTGAAGACG