Description :
From Genome Similarity Track
Location :
Scaffold_279:36080- 37770
Sequence
1690 bases(100 bases per row)
TCGGCAACCCGGAAAGATCCATGCCACATATGCATTATCTTCTTATCAAAACATATTCAGTCTATTCAAATAATGCTCACTTGCGATCCGGACTCAGTTT
CATGAGATACTTGATCAATTTTATGCATATAGGCCGATCTTGGTGTGATCGCTTACTACTGCTCTTGCACGCTGATATGGAAGCTGTATGTTATATCTTC
ATCCAAGCGGTTCCGAATCGCTTTGTTTATTTCTCCCTAATGGTAAGGTAGCCTCTACTTGTGATCGCGGATCTCAGCCGTGAATCAGGTAATATAGTTT
CCTAACGAACAAGATCCTGGGCAGTACTAAAGCGAATCTTAGTTTTTCAGCATATTTTCTCAGTCTTTTTGATTACATATATTGTTAATACTCGTGCCAG
TATTTGCATTATAAGTCCTACAGTCCCATTTAATTGGAGCCTGTACTTAATAGTTGCACACAACATTTGTCTAAAGATCCAGTTAAAATCATAAAGAAAA
TCGGACGTAATTTCTGGCTCCCTATCGTGAAGGATAGCTTCACTCGCACCAAACCAACAAGAGACATGTTCTTCGTAAATATAAGCAATCTCTTGGGCTT
TTTAAGATGAACCCATTCTTAAACAATCGAGATTGTGGGATATGATCGGTAGCGGTAAATTGAAATGTACATGTAGCCCGCATATTTCGCGTGATCCACC
ATGGATTACAGGAATCCCTTTCTGGTCTCACAACCTACATATTATCTTGCATAATGTTGTACTCTTATATGAATCCTCTCTAGTGGAAGTTGGATTTATT
CCGCTGATCAGTCCTATCGATTTCTTGGTGACCACCTTACAGGCTCGTGTGAAATTAGTGTAAAAAGTCTCGTTGTAATGATTCCGGGATCAATAATCGG
ATCGATTCCACACTATCCTCAAAGACCCCAGTTGATATAAAGGCAGTAACATATAAAGATGCCCGCGTCCACATCATAGCTCGGTATAATCCCAGCTCCG
CATTCTACGTCTTCTACGCCTAACCGTTTGACATTCCCGATCACATATTCCGTTAAGTTAACAGCCATATCTCTTCTTCAGGTTCTTGCTTCACCTGATC
AACCTGACCTGTTGTAAAATCTTGATTTGCAAACATTGGGATGTCAACGCCGTCTGACCGCAACCCTGGTAATTGCAGCCATTTTCACTAAGCGATCGAC
ACAGGGTGACGTCAGCGGTTTGTCTAGGCGGTAGCAGAGATCAAATTCCGTAAAGTCGATCCAAACTGATGATCGTGCCTTTTCTGTTGCAGAGGAATAA
TTTCCAGCCAATCCGTACCTTCGATCTAGTATCGCTTAGAATGCCATAGGTCGACCATGGTCGCAGCTTCTCCATCTCCGTACGACGTATTAGCTGTTAT
CAGGCGCTTCGCAAAAGATTTCATCTCACACCTGCTGGATTACTAGGCTGTAATCACCACAAAATCATACCACGTGACCTAGCTTAATCCGTTGACTTTC
ATATCCGTTGCGTACTCCGACGAGGCAATCGCGATAGACCACTTTGGCAGATTCCATATTGTCGCACTATATCACGTTTTCGCTTTGTTCGTTCTGATCC
GTCTTAATTGGCTACAAAAATATGCTCGCCCTTTTCTACAGTAAATTGGGACATATTGATGCTATGCCTAGCCTGTTTCCATGGGGCGAT