Description :
From Genome Similarity Track
Location :
Scaffold_1:3607939- 3614318
Transcript NameFunction/comments
Physo_322998Hypothetical protein

Sequence
6379 bases(100 bases per row)
GTTCCGACAGTCTACGAGGCAACATCGGTCCCCGCATCCTTCAGAACGCCACCCAAGTCACTCGTATCAACAGCAACGTCTCGGATTTCAGGAGGGTCTT
CAGGGGGCACCTCTTCAGTCTGAGTTGCAGCGTCTTCAGCGAAACGCACGCGACGAGTCTTCGGTTTCCTGAGAATCAAGGCAAGCAGTGCCATGTCGGG
GCCCTTTGCAGGTCGCGGCAGAATCTTCGTAGGCCACTGATACTCTGAGGTCTCGACACAGGATGGCTCCAGCGCAGCCAGGCGTTCTGCACTAAGTCTG
CCCTCACACGACTGAACACTCTCCAGAATAAGAGTCTGCCACTCCCGGTACGCAAAAGAACCAGGGCGCACAAAGCGTCCGGCACGTGGGAAGAAGCTAT
ACTCCACGATTCGGGCGACCGGCGTTCTGTTGTGAATCCAGCCGTCCTTGTCCGAGATGTTGACCACCTTCACAGCGACCGGCCAGGATCTCGCAGCGTA
AATCAGGTGCGTTACCCAGCGGTCACCTCGTCCTGCCCACACAACTTCACGCTGTGGGTTCGTCGGTCCATACGAAATCTTCACCACCTTGGTTTCCCCA
GGGGCCAGGTACCAACTACCTGTGGTTTCCACGGGCATGTCGACACCCAGGCGATCTTCTGGAGTCCATCCACACATCGTGATCGCCTCTTCATCCGGAA
GTGTCACGAGACCTTCGCGAACACTGATCCTCACTCCAGCTGCAAACATAAAACTCATACCCAGAAGTACTTCGATCCCTTCGCCGATGTTAGCAATCCA
GACATCCAGGAGATCCAGGAGATATATCACCCTCGAACCGAGAGTAATCTTCACCTGAGCACTGGCACCGATGTACGTCGGAACGCCCCCCATGCCAGAC
ACCTTGGTTTGCTTGTGCGACTTGAGTGTGAGTCCGAGCTTACGCGCTAAGTCGAAGCTCACAATATTCACAGGCGCACCGGTATCCATGAGAACTCTCG
TCCGGCAGTCGTTCACAGCACCATGCACCATCGCCACATCACGTTTCTTTTGGTCAGGATCATTGTTTTCCCACCATCCGTAGCGCTCTCCAGGGTTCAG
CTTGTACTCCACATTTTTTTCAGAGTTCACCGACCCAGAGTTCGCTTGTTCAGGATGCTGAGTTTCAGGGGAAGTCATGAAATCCTGAGTCAAAGTAGTC
ATGCATTGTTGGTTATCTTGGGTTCTTGTTCTCAGCTCCGGGCCTACATACACTAGAACACATAACTCTGGGGCCTTCTTCAGCCCGGCGCGTACTGGGT
CCCCACCCAGCGGGCTTATTGGTTTGACGGCCTCCCAGAGTTTGCTTCGCCATCCAGGAGTTTATCCAGGATTTGGCTCGGCATGTCCTTCAGTGCACCT
TGGCGGGCGAGTTTCTTCACAGCTTCCAGTGTCTTCCAGTCTTCACACGGTTTCCCGAGATGCAGTTTGCCACAGTTCTCGCACGGTTGCGCGCGACACA
AGTGAGTCGGATGACCCACTTCAAGGCAGCGATCACACTTCACGTCTTTCCAGCAGTTTTCCTCTGGGTGCCCCCACTTACCGCACTTCTCGCAGAACTT
GTCCCAATTCGGGTTTTCGCGGCGAGGGGAACGGAATCCAGAGTTCGCGCTCGGTCCTGGTTGGACGTTCGGTGGACGCCATCCCATGTTATCCATCACG
CGATAGACCTCGTTCGTCAGCGTCTGAGTCCAGTCGGCACCCTTCATACTCGCCAGGCTCCCAGCGCTAGACGTAGAAGTTTCTTCTCCAGAGATTTCAC
GAGTTGACCCTGAATTCGCGCTCGCACTTCGAACTGAAACTCTGGGTTCGTCCCTGATTTCCTGAAAACGCGCGTGAATTTCAGGGTCTTCATCCGACTC
AGAGTCAGAGACATCGCCCCTAGCCACGTACGCACGTCCTGCACGCTTCGGCTTGAAACGCCCCTGAGGAATGTTGTCGGCACGAAAGTCACGAACTCTG
GGTGGCGGGGCATCATGGTCGCTGCGACTCCAGACCTCTTCGTCCTGTTCCAGAGCGTACTCTAGATCAGCGATACTCCTGAATCTCTGGCCCTGCAACG
ACGTTTTGAGGCGTGTGTCCCTGAGTTTCGTGATGAACCTCCGGATATGCTTCTCCAGACGCTTCGAAGACTTGCGAAAGTCAATGTCAACCTTCCCAGC
GGCGGAATGCAGACGATAAAAGAAATCCAGGTCGCTCTCTGAGGTCTTCATCTCCATCGTGAAGTAGCGTTCAGATACGACGAGCGCGCTTTGCAGTACT
TCTTCCTGAATGCAGACGCCAACTCCTTCCAGTCACGCTGAGTGTACTTGGGCAACTTGTTGAACCAGTCACGCGCTCCCGAGAGTTCCAACATGAGTTC
CTGAATTCGCATCTTCGTAGACCAGCTTCCCTGAGCCGCCATGTTCGCAAAAACGCTCCCACCAATGCACGCGTTCCCTGAGTGACGCCTTAGTATCGAA
CTCACCCAGAGTATTCGAGTTGATGTACGGTCTGAACGTCAGGAGCGTAGTGCAAGCTTGAGCCGTAGAAGCCGTCATCAGGTTACCCCAGGGTTCCCGT
CCGAACTGTCATCCGAACTCTCAGAGGACGAGTCATCATCGCTGGAATCGGAGCTTGGGTCTGAGTCCGAAGGTGGATTGACATCCTGACGCTTCTTCTT
CTGCTGGTGTTTCTTGGGTGCAGAGCGCTTGGAGTCTGCTTTAGAGTCCTGCGAGGCCTTAGAGGCCACTGTTCTCCTGGGATCCGACGTCTTCCCCAGA
GACAGCTTGACATCCTGCATCACCTTGGTCTCCGTAGCGCCATGTCCCCGCTTGACGCGCGCGATTCTGCCGGAAGTGTCGGCGGAAGTCTGCGCGAGGG
TCGCTCTTAGCTGGGAGGCGGCGACTTCGGAAGTGTTCTTCGGATCAGCTGTCTCCCGTCTCTGGCCAGCGACACTTGCGTTTCCGTTGATTACGCCACT
GGATTCTTGGGGTCGGGTTGCAACTTCAGGGTTCTGAGCCACTGACGACCTCACATTTGTTGCCAAATCAGGGGCGACGGTTGCGCGACGCGCTTGAACT
TGGGCCAACGTTGCACGAAGGTCGCGCACTTGGCCAGCGTGGAAACGCTGGATATTCTCGGAAGACTCCCGCTCTCGCTCTCTCTCCGCCTCAAGTTCTT
GGACCTTCTGCTCCATAGTTGACATTTTTTCCTTCCAACCAGCGTACGTCTCGGAAACCCAACGCGCGCGCTCCGAGTCGGCTTCGGCTTCGCGCTGTTG
CCAGCGCTCGGCGTTGGTGGCGTCCAGGCGCTCACGCTCAAGACTTACAGCTTCCGTGATACCCTGGGTCATCCCCTGAGTTTCAGTGGAACACTGGGTC
TGGCGAGCTTCCACGTCCTGCGCACGCCGTTCCCCTTCTCCTCGGGCGATCTCAGCGTGGACCAAGCGATCCGTAAGTTCTTGGATCTGTCGACGCGCGT
CCAGGTCACGTTTTCCCTGAGGCGCTCGCGCTCCAAGGCATCCAAACGTTTTCTGGCGAGAAACTCGCGTTGCTCCTGTTCCAAGCGGGCCTGCCACTCC
TGCTGTTGTCGCAAGACGTTCAGCTCGATTTGGGCGGGGCCAGACGTCGCGGACACGGACGAAACTGATCTAAGATTTCTGGATCCACTCGAGCGGCTCG
ACGCAGCGGATTTTCTGGATTTCGTCGAGCGTCGAAAGCGCACCTCGCTCCTAGAGCTCTGGTGTTGACTCCGCTCATCGGCGCTGACATCCCTCGGACC
ACCAAGTCCAGAAATCGGGGCAGAAACCCTGAATTTCGGCTCAGCCATCGTGGCTGAAATTCTGGGGAGACCGGCCTTCCCGGGTGCGATCTCTGGGTCA
GAGTGCACCGACGATGCCATCTCAACGTCATCTTGGTCGACTGACACAAGACGCGACGGGATGACTGCCCGGGTGACCTGAAATCCAAGATCACCGGCAG
CTGCGAAGCCACCGGCTCTCTGGGCCACAAGCGCTAGAGCTCCAACTCGTCGTCCAAGCGACATCATCGACGAAGATGAAGAGCTACCATAAGACGTTTG
AACGCCCGAGGCAGTACTCTCATCCGAAGCGCGCGAGGTACGGATGACACTTGGCACCGCGCCTGGGGTAGCGTCCTTGGCTTCCGCCTCCAGAGAATCA
CGTCCATTGGATATGGAATTCAGGGGAGTGGAATTCTGAAGCGAGGCACCAGTTGAAGACTTGTACGCTGGAAGAGAGGACAGTGACGATGTAGACAGCG
CGGATGGCGTCGACGGGACTTGCAGGCGAGGCGGTCCATGCTGAGTGCGCTTGGATCGCGGCTCACCATCACTCGACACAAGTGAGCTCCGTGAAATCCT
GAGTCCAGTGACTCTGAATCTCAGGACAAACTGTCGGCCCAGTAGATCCGCATCGTAGTCCGTCATCAATAGATCACCGTCTCCGTCTTCCTTGTGGTAG
TCCAGTCTTGGTGCTTGCTCTTGGGCGCTTGGTGCGGCGTGATCTTCGGAGTTTACCTTGAAAGGCACACCAGCTATCACCAATCTCCACTCGACCAGTT
CCACGGCGATGAAATTCTGGGTTTCCTCCATGACAGAGCGCACCAGACTTTCTGGAATCCTGGAAGCACGCGTCGAAGACCAGCCAGGGATCGAGTTGAC
AAACTCAAATCCGGCTTCGAAGAACAGTGTCTGCAGAATGGCGACGCACTCGCGTGCGGTCATGATACTCTGGGGAATTGTAGTCGCCATGAGATTCTGG
GCAGTTCCGACACCCCACCGGGCAAGGTGAAACTCAGAGACCCAGGCTTCATCCTGGTTCGCCAGAGACAATCGCCACTTGAAGTAGTCTCCCGTTGCGT
ACGCGGCCGCGAAGTACGAGTTGGCATCCGGTTTCGGAGTCGGCCACTCATAAACGACACTTGGCGGCGTCACCTTCCCAGGGTTCACCTCTTCCCAGCG
TCGAACCTCACGTCGGACGTACAGCACCATGCTTTCAGCGTTCAACGCCGTTGCTCCGATTCCGGAGCAGGCGCAGCAGCTTCCCGGATGTTGCATTCAG
GCGTCTTCCTAGGTGCCGCCTGCGAACTTGGCGCTGAAACTCTGGGTTCAGGTGGTGCGAACCCAGAATTCACCTTGGAACTCTGCAGCGGGGCTGCCGT
AGCTCCTTGCGTAGAGGAAGACTTTACGACTCAAAGAGTCCAACAGGGTCCTATCCGAGGACCCACGAAAACAAGTCAGAGACTTCTTGCAAAAGGCAAA
CTGTATTCATTCTCTTATCTGCGGCTCCGCCGCCTACGGTGCAAATACCTGCACATAACTAACTCTAGTTCATTCTCAATGACTGGCTAGTGGCCCAGGG
AGTACCCCTTGGTGTATCGCACACCAAAAGGGTAACCACAAGGGTAACCTCCGTGTAACCCCGTTACAAACTCTGAGTCTTCGCCTCCTACTTCGCTCGC
ACGGGCTCCGGCTTCACTTCCACAACGGACTCGTCCGAAGATGAGACCAAGTCAATCACCTCCGGGGGCTCAACCGCATTGGCGCCTCCCTCAGACGCCT
GAGCACCACGCTCGCGGGTGTGCTCCTCTGGGACTTCAGGAATCCGCGACCCAGAATTCATTTCCGTCGAACCTTGGAACTCAGGGGAAACCTCTTCCTC
CTGAGTTTGCGATCCAGCAGCAGGCTGATCTTGAACGGCAGATGCCTCCCCGTCCACACCTTGCACTGCCTCGCTCTCGCGAGCAGCCTTCTTCGCCTTC
CGAGGGTCGTGGACGACTGTTTCCAGGTCCTTGTGCTCCTCAGGCTCAATACCTTGAACACGACGCGACTGACGTGACGCCTCACCGCGTCCTCCGTCAT
CGCGTCCACTCTTCTTCGCCCCTCGTCCTCCAGGCATCTTGGTAGCTTGAAGTTGACGGGCACTCAGGACTTCTTCAACACTTGATTCCGGTCAAATCCT
CGACAATCGAATCCGGGCACGCGCACCAGCTGAGGCGAGGCCGATGAAACCTTTGTCGCCCAGGGGGATTCGTATAGCGCAGCCCAAGACTGTTCCCCAG
GGGTAGACCCAGAGAATCGACTTGAGAGTCAACAGCAAGAAGATAGACCCAGAGATTCGCAGCCGCAAAGCTTTAAACCCTGAGAATCACACTCCTTGGT
TGGCGTGGGTACCTTGTGTAATCCCTGTCGGCTCGTTTGTCTTCGACGGAACGGCACTCCACCGGTTGAAAATGTAGCCTCGAAGAAGTGCGGGAGCGCA
CGTCTACTTCAGCACGCACCTCCACACCAAAAGGCAAACCCAGAGAATCAGATCCCCTGAAAACCAGAATATCACGAAT