Description :
From Genome Similarity Track
Location :
contig_24:360793- 362284
Transcript NameFunction/comments
g4584.t1hypothetical protein PHYSODRAFT_316061
g4585.t1hypothetical protein L915_07601

Sequence
1491 bases(100 bases per row)
TGGCTGCCGTGCTCTGCAAAATGCTCTCCAGATGAGGGACCAGATGCGCTGGCACGAAATACTCCGCCGGCTTCTGCTTCTGCAGCGCTCGCCGTGCAGC
ATGCGCCACCAGCGCGCCGATGTGGTCGATGTGCCCGTGCGTGATGAAAACGTGCGATTTTCCGATCACTCGGCCGGCGAGGCATCCCAGGTCGAACGCT
ACATCAATGGAGTCCACATAGCAGCAAGATTCGATGCCAGCCACGCAGCGCACGTGCAGCGTGTAGCCCCCGGTCACCACCACCTTCGGCTCGCTCGTGT
ACATTTCGATGATGTACCGTGGCTGCCAGAAAACTGCCGCGTAATCATAAAGATATACCGTAGCTGACGTTAAGAAGGCTACTTCGAAGCTGAAAGCTGC
CCCTGGTTGTATTGTATTGAGCGAGGTTGTTGGCAACAACCTCTTCGATCAGGACTTACCTCACGACATCAAGCTGGCAGCGTCGTCGCAACAACCAGGT
CTTCGATTAGGGGCGGTCGCACCAACAACTTGTTGTACGCCGGCACAAATCTAAATCGGCAAAACTCCACACAATACTTGATCCTGTTGCCAGCGCCTCG
CGTGTGGCGACGTCGCAAGGTCCTTCTCCATCACTGTTGGCGCAGACCTTGGGAGTCTATAATCAAGGCTCGCATATGGACAGCGAGCATCCACCCGCAC
GCGTTCAGAGGGAAGTTCGCGCAAGCACCAATCCTGCTCGAACGAAAGCTTGTACTTGCGCTCTTGCTGTTCACCACCCAGCAACACCAATGCACGCGAA
CCATGCTATTACAAGCTATTCCAGGCCTGTTGCGAACGCTTATTCCCATCGGCGCTGCCGACGTCGTCAATGCGATTCGCCTATTTTGACTTGACTACTT
CAGCTTCCATGCCACCTACGGTCTCTTGTACCTTTGACTCGACTTCACTATGCATGTCTCGGTCATTGGCGTGGGATCCGCTGAATGTGAATAAGTGCTC
GCCTTCCTCTGTCAGTCATTCCTCGACTTGCGCTGTGCACCAAACTGCAATGGTGTTGCCCTCTTCTTCGGCGATACGGCCGCGCCGCATCGCGCCCAGA
CGCATCGCGCTGGTGCTGGCCGTATGTGTCCGACCTGCTGCTCACGGGGCTTGTCTTTGGCTGGGCGCCGCTGCTGCTGCTGCTGCAGGAGGAAGGCCAG
TACCACGAGCTCTGCTCGGACCCGATCGAGTCCACGTGCGTGGCTCAAGAGAATCGCCTCAACCTCGTCTTCGCAGTGGCCTCCGTGGCCATGAACGCCG
GCGCGCTGCCTGTCGGTATGTTCCTGGACCGCGCAGGGCCCCGCGTGACCATCGCGATTGCTGCCATCATCGAAGTCTCGGGCCTGACAATGCTGGCGCT
CGCAGACTCGCAGACTTTCGACCTGTTCGTGCCAGCCTACGTGCTCATCGCGTTCGGAGGCTGCATCACCATGATGGCGTCGTACCCGGCC