Description :
From Genome Similarity Track
Location :
Scaffold_377:3605- 4861
Transcript NameFunction/comments
Phyke_g8983hypothetical protein PHYSODRAFT_555553
Phyke_g8984hypothetical protein

Sequence
1256 bases(100 bases per row)
AACAAATTTTTCCACGACAAGGATCTCTGAGCGGGGAGTGAAGTGAGGGTATGATTACAGGCTGGCGATGGTATCTACATGTAGAAGCTGATACTTGTGA
ATCTAACTTGCCCCGTGGCAATGACACTGTACCAACCCATAGTGTATGTACATAGCTTCTCGACTCGATACTAGTGGCATGCCACCGTACCCGTAACAAC
ACGTTTCCTACTGATCCTGTAGTTATTCGCAATGCATTTGACGTTTGTGCCGCCTTTTATGTCGTCACCCCTGTGCATTGATTGACAGTTCATCTTATTG
GGATGCTAGATAACTGGGATTAGGCTTTTCGGCTGGAAAATACTTTGCCTTGACCTCTGCAATTTGCTTAGCAGTCCCAGGCCAAAACATTTCGCCCGGA
GCATGCTTAAATACCTGTTTCGAAAGCGTCATCGCCCATCGACCAGGTTGATCCACTCTACACTCCATAGTGAACATTGCAGCAAAGTTATCACCAAGGT
ACTTCGACATCCAAGCGCGCGGATTTTTCGGATCTCTCTAGCTTGGTAGTGTCATACTTTGTTCCGACCCTCGTAGGAACGACTCAACCTTTACATCATC
CGGAAATTGAGCGTCGTGAATTTCCCATACACCCCTTTGGCCGCCTTTCGCAACCACTTGCTCTAGAAATTCAAGTCGAGCCGCCACAAGTGCATAAAAC
ACATCACTTTCTCCTGCCGAGAAACCCACTTTGTCCGCATACTTTGCGAGGCCATCGATAACTGTATCCCAGTAGTCTGGACCCAGGTGGTGGAACAATT
TCACCAAGCTGTCAAATACAGTTTTGTCACCACATCGGTTTACGCACCCCCACAGCTTCTCGATTTCTGGATACTGACCAAGGCGATGAGGAGTCCAATA
TATTGCCTCATTACAGAGTGACTTGAGAACCCCGTCTGCGCTTCGTTACCATCAAGAGAATCTGCTACATGGACCGTGAGATCAAGAAAGGTTCCGATGG
TCACCTCTCCAAAGCACGCTACATACAGCGGCTCAATAGATTTCCACCCAAACCTTTCTACAAGACTGGTAACTGGCGTAGAGAGACCCACGTCGACGTA
TTCGTTGCACTCGAACTTCTTGAAGAAAATCTCAACTAGCGCCATATCATTCGCTTTCATCAAGCAGCTACACACCGTTCGACACCATTCCATTGACGTG
TCATCAAAATTGACTGAGTTTTTAAGTAGTGTATGAAGCTTTGTTGGGTCAGCCAG