Description :
From Genome Similarity Track
Location :
Scaffold_2:360491- 361608
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001045Similar to ZBED1: Zinc finger BED domain-containing protein 1 (Homo sapiens)

Sequence
1117 bases(100 bases per row)
CTCCATGTCGAATAAGCTGGAATGGCGCCGACTGCGCGGTCGAACCATGGTGGTCCGTACGCTGCAGCTTTCGTTTTCGTCCTCCGGTGTTGCTACTACC
ATCGCCATTCGCGTTGGCACTGTGCTGCTGGTGGGTGTTGTTGGCCTGCTGCAGCGCTTTTTGACGCTTTTTCTCGCTCATCTTCATCTCGTAGCTCGCG
AGATCTGCGGGGTGAAACTTGGCCATGTGGCGGCTCACATTGTTGCTGCTGCCCGTGTTATAATGCATCATACGCTTGCACTTGAGACAATACGCCTCTT
TCGCGTCCTGGTTCGTGTACTTCTTTCCTGCCGCCACAGTCGGAGGGTCCGGTACCACGAGCCGAATGAACTGCCAGAGCTCGGGACGCCGCATCTTGCT
CGTCTTGTACAGCTGCAGCTGCGTCGGAGGGGAGCTCTTCGTTGTAACCTGCTCCGACGACTCCGTCCCCACGTGCACCACGTCCGATGATGTGGATGTC
GGTGTCGCGACGTCTACTTGTCCTGCCGCCTGCGTCGTAGAGGGCATAATTTGCTGCTGCTGACTCATGTGCGCTTGGATGAATGAGCTGCTCTCATTCG
GCACCGTTTCTATCGTCGTGCTGTTGCTAATCACGGGCGTCGTTATCGTCGTGGTCGTCGCGACTGCTCCGGTCGTTGCAATCGGCGCCGTCTGCTGAAC
CTGTTGCTGCTGAACCTGTTGCTGCTGAACCTGTTGCTGCTGCACCTGCTGCTGCTGTATATGCTGCTGCGTCTGCTGCATCTGCAGATGCTGTTGATTT
GACGTCGGGATGCTGTACGCCGCCATGTCGCTGCTAGTGTGCACTTCCATGAGCGTCGTGGCGGCGGGCGGGATCGCGTCCATCGCGGGGTACCCTCTCA
CGCCGCCTCCCGCGTGGAGCTGCTGCTGGAACTGCTGTTGTTGGAGCTGCTGCTGTTGTTGCTGGAGCTGCTGCTCGAACTGGAACTGCAGCTGCTGCTG
CTGCTGCTGCTGGTGGTGGTGGAGCGCCGCTTGCGTCTGCGTCGCAAAGTGCGCGTGCAGCGCGAACTGGTGCAGTTCCTCCTCAGGCGCGTCCATCAGG
CGCTGCTGCTCGGCCGC