Description :
From Genome Similarity Track
Location :
Scaffold_212:3604- 5986
Sequence
2382 bases(100 bases per row)
AGCAAGGTGAGGATACGTGGATGGCGGATGGAGCGTTCCATTCATGAAGAACGGGCTATTTGTGGTAAAGCATGCACCTTGTTATTGATGGCAAAAAGTA
CTCCATCGGTAAGAAACTACTCGACCATTTGAAAGATTGGACGTATCATCGAAGTATCGCTTTGAGGACAAGATCGATGTTTTCCTTTTTCCACCCATTT
CAGGTGATTAGAGACACCTATCAGTGAGTTCCAAGTAATTGAAATATGAAGCGCCACCACTCTTCTGGAAACCGTGAGGCTCGGTCACACAGAATTTCAC
GGGTAAACCATGAATACAAAAGATCATTTCAATACAAACACAAGCACAATCTATAGCTGTGATCAACCCTAGAATATCAAAAAGATGCAACATCTTGCTG
AATCGACCAATAAACACAAGAATACCCATATAACTATGGTCAACCTCGCGGATACATGAAATGGATTCCATTGAAACAGACTCCCAGCATTCTGGTGGAA
CTGGTAGAGGTTGTTGTGGTGTGTGGCGTGAAGGAAAAGACTTCAATATTTGTCATGCCTCAAAAGCACGGACTTCCTTGCGCGCAGATCAGATTATAGC
GGCATCAGTAAAATTTCGGCTAGCTGTGAGATAATTTTCCTTTCTACCTCGACGGCCACTGAAAGGAGCTTTTTGGCACTCATAAGTAATTCTCAGGCGC
ATACTACTATGTTTAAGAACTCCGAAACGTGCTGTTACGCCAGCAGCAGCTGCGTAATACAGCAATCCGTTCCGTAAGGTGTATAAATCTGATGAGCATG
GATATACCGCCGAAAAGATGTTCAAGGTTTGTCGTGATGAATATGACAGATGATTCATCAAGTGCATAAGGTTTTCATCATGTGCATATGCATTTCTTAC
TTTGTCAAGAGAAGTTGAAGACTGTATAATTGAAGTTACCTTTGCAACAGTGGCTGTCACACAATTGAGATGTGCAGCCGGTTCGAAATAGAGCAGCGCA
AGAGAGCATCGTCTGATAAATTAAGTTATCATGGTTTATACTCGAAGGAAAAGTTATACCCCGCAAGTAACTATATCTACTCCATGCCAAAATTTGATAG
AGGTGTGTAATTTGTACAGACGTGCGTAATGACGCAAGGTCCGTATAGACGACGGTGGGTCCATCCCCTACTAGATAGACTGAACTTGCCAGTGTGTGCT
TCATAATGAGGTGCTCCTTCTCATACACAATATAGTTGCGCTCAGATGTAGCAATTATATCAATTGATCGCAGAAGACACGCTCCGCGCCTTCTGTGTGA
AACTTCATTAATGCCCAGCAGCATTCAAATCACTGGAGTTACAAGCTACGTAAATGGTATGTATTCGTCCGCAACCGGCAACGTTGATCATAGTATCAAA
CTCTGCTTGATACGTCGGAGGAGCGCTGACCTATCACCACTACAAGTCCACTTCACGTTTTTGTTAAGTAGAAAATACGGGTGCTCAGTTATTTCGGCGT
TGTTGCGTGAGTACTTGTGCAGAATGATCTGCTAGTCCAGTGAACGTGTTAAATCTCTTGACATCGACTGGTATTACCCATTTGAAAATTGCCTTGATAT
TTCTGGATCAGAGAGCACGCCGTTATTACCGGCGATACATCCAACCGAGGGTCTACTAGCCGCAACAATGAACTTCTTGAGGTTGTCAAATTTCTTATGC
TTTCGCATAACAGTAACATGTGAAGGCGGTTTTACGAGCCTCAGCGTAAGACTTTTCATCTATATTTCGTCTATAATCGGAGACATCACCGATATACCCG
GTTCGAATTCTTTGCACCTGTCTTAACAGATGTAAAGCACGTATTTTGAACTTAACTGGTGCTTTATTAAGCCCTCGCGCATTACCATCCATTCATCGAG
CATACCACATGTAGTATTCATTGCGGTATATGATATAACTCATTCCACATATGATGGAATCCTTCATAGAATGCATAGACGAAACGATGGAAGTCTTATA
CATGCGATCCATGATTACGTCTTCCCTTGGTATAGACGTCTGAGTCAGTACCTTTTCTTCATTCACTTTGCTGATGTTTTTGCATTCTTTGTTGAATGCG
TGCACTATCCGACACCCTCGTGTCGTCTCTCACACACAGAAGATTAGATATCTATGTGATAACGTCGATTCCTTCATATTTTACGCTGCTAAGCGATCGG
AAAATAATTTGTCGTTTACTACGAATTGTTCTCGAGGAAGTAGCACTGCATAATGATACTGTATTTTAAACCTGTTTTTAGGTCTATCTTGTGATGCAGA
TAGTATAGTACGAATTCAAGTAACACATTCTTGAATTCGACCAGATCGTCATAGAGAAGGACTGGAGTGACTTCCAAGGTTG