Description :
From Genome Similarity Track
Location :
Scaffold_162:36032- 37911
Transcript NameFunction/comments
Albla_Nc14087940chromodomainhelicaseDNAbinding protein putative

Sequence
1879 bases(100 bases per row)
CAAGTAGCCGCGGTGCTCGAACACTTTGTGACGGAAGAGAGTATCCGCGGGCCGTTCTTGATTGTGGTCCCATTGTCCACGATTCAGCACTGGCGACGCG
AGCTGCAGGGCTGGACAGATCTGAATGTGTGCGTGTACCACGATATTGGCGATCGACAGAATCGCGGGTTCAATTCCAAAGATATGCGGGCCATGATCCG
CATGCACGAATGGTATTATCCAGATCGAGGGAATAGCTCTATCTTCCGTTTCCACGCACTATTGACCACATTCGAGACCATCCTGGCAGACTTTGAAGAG
TTTGAATCGATCCATTGGCGGCTTTTGATTGTGGACGAAGCACATCGACTCAAAAGCGCGGGCTCTCGCGTGCTCAAGCAAATGCGTGTGCTCCATTGTG
ATCGAAAGCTTTTGCTCACTGGTACACCGCTGCAGAACAACATGCAGGAGCTCTGGGTTCTGATCAATTTCTTGGAGCCTGTCAAGTTTGCCAGTTGGGA
AGACTTTGAAGCTAAATTCGGACGATTGCAGTCGCATGAGCAGGTGGTCACACTCCAAAAACTCTTGGCGCCATATGTTCTCCGACGCGTGAAAGAAGAT
GTCGAGAAGAGCATCCCGCCCAAGGAGGAAACGATCATCGCTGTGGAGCTCACAACGCTCCAGAAACAGTATTATCGCGCCATCTACGACAAGAACCAGA
GCTTTTTGTATCGAGGGATTCAGAATGGGCTTCCGCGACTTGTGAATATCCAGCTGCAGCTTCGACAATGTTGTAATCATCCCTTCTTGATCAAAGGCGT
TGAGGATCGTGAGCTTCAGGATCTTGGGCCGGAGCCTACAATGGATCGCATTATGGACAAGACGATTCAGTGTTCGGGGAAATTCGTTTTGGTGTCGAAA
TTGCTTCCGAAACTCAAACGCGAAGGACGCAAAGTGCTCATTTTCAGCCAATTTCTCAAGCAATTGGATTTGTTGGAGCGCTACTGTGAGTATCACGGCT
TTGGGTACGAGCGATTGGATGGATCCACCAATGGAGCAGCTCGACAAGCGTCTATCGACCGCTTCTCTCGACCGAATGCCAAGTCGTTTGTCTTTTTGTT
GAGCACGAAAGCCGGTGGTGTGGGCATCAATCTCATCGCTGCGGATACTGTGGTCATCTTTGACAGCGACTGGAATCCACAAAACGATCTTCAGGCCCAA
TCGCGTTGTCATCGCATCGGACAGAGCAAGACGGTGCAGATCTATCGTCTGGTGACTCGAAACACGTATGAGAGCGAGATGTTTGAGCGTGCGTCGCAAA
AGCTCGGGCTCGAGCACGCAGTGCTGGGCTCCGGCTCGTTCAACGATGGTGTCCAAGCCAACAAGCCCAGTGCCCAGGAGCTGGTAGATCTGCTCAAGAA
GGGCGCTTACGCCCTTTTAGAAGACGATCAAGCTTCCAAACAGTTTGCCGAGCGCGATATTGAGACGATTCTTCGCGAAAATGCGCGTGTGTGCACTATG
AGCGCAGATCATAGAAAGCAGAAATCGCTCGCTGGTATCGCTGTGGATCGGTCGTCTTTTGTGGCCGATGGGTCCACGGAATTGAGTGTGGACGATCCAA
ACTTTTGGGAGAAGGTTTTGCCCGGCGCCATGTCTGTGGAAATGTTGAGCATCCAGCTGGAGGATGGGAGCGCGTACGCGACCAGCGAGGCCAAGTCCAA
GTTTATCGGGAAGCTGGGCATCGCGTTGGATGCTCTGGTGCTCGACAAGACGGGTGATCATCGCATGGGTTTGGAGCGCGAGTACGACTTGGCGATTCAG
GTGCTCCATCGAATCAGTACGAAACTGAGCAAGCATTTTACCCGGCACCTGGAGATCGTGGGGACGTACCTCTCGCGTC